Deaf1 (NM_001282073) Mouse Untagged Clone

CAT#: MC227764

Deaf1 (untagged) - Mouse deformed epidermal autoregulatory factor 1 (Drosophila) (Deaf1), transcript variant 3


  "NM_001282073" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Deaf1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Deaf1
Synonyms AU042387; C230009B13Rik; NUDR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227764 representing NM_001282073
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGACTTGCAGCTTCTTTGCAAAGGGAGAAAGAAGTGACCACAGTGACTGTGGCCAACGTGGGGTCCT
CTGCAGATAACGTCTTCACAACATCAGTGGCAAACGCAGCATCGATATCAGGACATGTCCTGTCTGGTAG
GACAGCCCTGCAGATCGGTGACAGCCTGAACACTGAAAAAGCCACACTAATAGTTGTACACACAGATGGG
AGCATTGTGGAGACCACTGGGCTGAAGGGCCCAGCAGCACCTCTCACTCCAGGTCCCCAGTCTCCTCCTA
CCCCACTGGCACCTGGCCAGGAGAAAGGTGGTACCAAGTACAACTGGGACCCTTCGGTGTATGACAGCGA
GTTGCCTGTGCGCTGTCGGAACATCAGTGGCACGCTCTACAAGAGTAGGCTCGGCTCAGGTGGCCGGGGC
CGGTGTATCAAGCAGGGAGAAAACTGGTACAGCCCAACTGAGTTTGAAGCTATGGCAGGAAGAGCCAGCA
GCAAGGACTGGAAGAGAAGCATCCGCTATGCTGGCAGACCCCTGCAGTGCCTCATTCAGGATGGTATTTT
GAACCCTCACGCTGCCTCCTGTACCTGTGCCGCCTGTTGTGATGACATGACTCTGAGTGGCCCTGTCAGG
CTCTTCGTCCCTTATAAAAGGCGCAAGAAAGAGAATGAGCTGCCCACAACTCCAGTGAAGAAGGATTCCC
CCAAGAACATCACCCTGCTTCCTGCCACGGCGGCCACCACCTTCACTGTGACACCCTCAGGACAGATCAC
TACCTCTGGAGCACTGACCTTTGACAGAGCATCCACTGTAGAGGCCACTGCTGTCATCTCTGAGAGCCCA
GCCCAAGGTGATGTCTTTGCAGGAGCCACAGTGCAAGAGGCAGGTGTGCAGCCTCCCTGCAGGGTTGGCC
ACCCTGAACCCCACTACCCTGGCTATCAGGACAGCTGCCAGATTGCCCCGTTTCCAGAAGCTGCATTGCC
AACATCACACCCCAAAATTGTCCTGACATCGCTGCCCGCATTGGCCGTGCCACCGTCCACCCCCACCAAA
GCTGTCTCTCCCACCGTGGTCAGTGGGCTGGAGATGTCAGAACATCGGAGCTGGCTGTACCTGGAAGAGA
TGGTCAACTCCCTACTCAACACAGCTCAGCAGCTGAAGACGCTGTTTGAACAAGCCAAGCAGGCGAGCTC
TTGCAGGGAAGCTGCTGTGACCCAGGCGAGAATGCAGGTTGATACAGAGAGGAAAGAGGACTGGAAAGAC
CATCAGCATGTGTGTGGCCAGTCAGCGTCTGTCACTGTCCAGGCTGATGACGTCCATGTTGAAGAAAGTG
TGATAGAAAAAGTTGCTGTTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001282073
Insert Size 1353 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282073.1, NP_001269002.1
RefSeq Size 2032 bp
RefSeq ORF 1353 bp
Locus ID 54006
Cytogenetics 7 F5
Gene Summary Transcription factor that binds to sequence with multiple copies of 5'-TTC[CG]G-3' present in its own promoter and that of the HNRPA2B1 gene. Down-regulates transcription of these genes. Binds to the retinoic acid response element (RARE) 5'-AGGGTTCACCGAAAGTTCA-3'. Activates the proenkephalin gene independently of promoter binding, probably through protein-protein interaction (By similarity). Regulates epithelial cell proliferation and side-branching in the mammary gland. Required for neural tube closure and skeletal patterning. Controls the expression of peripheral tissue antigens in pancreatic lymph nodes. Isoform 1 displays greater transcriptional activity than isoform 2. Isoform 2 may inhibit transcriptional activity of isoform 1 by interacting with it and retaining it in the cytoplasm. Transcriptional activator of EIF4G3 (By similarity). May also involved in behavior (PubMed:24726472).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) represents use of an alternate promoter, differs in the 5' UTR, and has multiple differences in the coding region, compared to variant 1. The resulting protein (isoform 3) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.