Kcnj15 (NM_001271694) Mouse Untagged Clone

CAT#: MC227504

Kcnj15 (untagged) - Mouse potassium inwardly-rectifying channel, subfamily J, member 15 (Kcnj15), transcript variant 10

USD 382.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Kcnj15 (NM_001271694) Mouse Untagged Clone
Symbol Kcnj15
Synonyms 4930414N08Rik; AI182284; AI267127; IRKK; Kir4.2
Vector pCMV6-Entry
Sequence Data
>MC227504 representing NM_001271694
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTAGCCAGGTGGGAGAAGGGGAGCGAGGACGCGCCACTTACCCTGCAGAAGATTCCTGACCTACAGA
GTGGTCCAAAGATGGATGCCATTCACCTTGGCATGTCCAGTGCCCCACTGGTGAAGCATACCAACGGGGT
TGGACTCAAGGCCCACAGACCCCGAGTCATGTCAAAGAGTGGGCACAGTAATGTGAGAATCGATAAGGTA
GACGGAATCTATTTACTCTACCTCCAGGACTTGTGGACAACCGTCATCGACATGAAGTGGCGATACAAGC
TCACCCTATTTGCTGCCACCTTTGTGATGACCTGGTTTCTGTTTGGAGTGGTCTACTATGCCATAGCCTT
TATTCATGGTGACTTACAACTTGGGGAATCTAATTCCAACCACACACCCTGCATTATGAAAGTGGACTCT
CTCACAGGAGCATTCCTCTTTTCCTTGGAATCTCAGACAACCATTGGCTACGGGGTCCGTTCCATCACAG
AGGAGTGTCCCCATGCTATCTTCCTCTTAGTCGCCCAACTGGTCATCACCACATTGATTGAGATCTTCAT
TACGGGGACCTTTCTGGCTAAAATTGCAAGACCCAAAAAGCGAGCCGAGACCATTAAGTTCAGCCACTGT
GCTGTCATCAGCAAGCAGAATGGAAAGCTATGCCTGGTCATCCAGGTGGCCAACATGAGGAAGAGTCTCC
TGATTCAGTGCCAGCTCTCTGGAAAACTCCTGCAGACACACGTCACCAAAGAGGGAGAACGCATTCTCCT
CAACCAGGCCACTGTCAAATTCCACGTGGACTCCTCTTCCGAGAGTCCCTTCCTCATCCTGCCCATGACC
TTCTACCACGTGTTGGATGAGACAAGCCCCCTGCGGGACCTCACACCCCAAAACCTAAAGGAGAAGGAGT
TTGAGCTGGTGGTACTTCTCAACGCCACGGTGGAGTCTACCAGCGCCGTCTGCCAGAGCCGAACGTCTTA
CATCCCGGAGGAGATCTACTGGGGCTTTGAGTTTGTGCCTGTGGTTTCTCTCTCCAAAAATGGAAAGTAT
GTGGCTGATTTCAGTCAATTTGAGCAGATCAGGAAGAGCCCGGATTGTACCTTCTACTGTGCCGATTCTG
AGAAGCAGAAGCTTGAAGAACAGTACAGGCAAGAGGACCAGAGGGAGCGGGAGCTGAGGAGCCTCCTGCT
ACAGCAGAGCAATGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001271694
ORF Size 1209 bp
Insert Size 1209
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001271694.1, NP_001258623
RefSeq Size 5061
RefSeq ORF 1209
Locus ID 16516
Cytogenetics 16 C4|16 55.86 cM
Gene Summary Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.