Cbll1 (NM_001253848) Mouse Untagged Clone

CAT#: MC227084

Cbll1 (untagged) - Mouse Casitas B-lineage lymphoma-like 1 (Cbll1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cbll1
• Synonyms: AI467391; c-Cbl-like; Hakai
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227084 representing NM_001253848
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATCACACTGACAATGAGTTACAAGGCACTAATAGTTCTGGATCCTTGGGTGGTCTTGATGTTCGCA
  GAAGAATCCCTATAAAGCTCATCTCCAAACAAGCCAGCAAAGTTAAGCCGGCACCTCGGACTCAAAGGAC
  TGTCAGCAGGATGCCCGCAAAGGCCCCGCAAGGATTTGATTATAACGAAGAACAGCGATATGACTGTAAA
  GGAGGCGAACTCTTTGGGAATCAGCGAAGATTTCCAGGACACCTTTTTTGGGATTTCAAGATAAACATCT
  TAGGTGAAAAGGACGATACACCAGTACATTTCTGTGACAAATGTGGACTGCCTATTAAAGTCTATGGGAG
  AATGATTCCATGCAAGCATGTCTTTTGCTATGACTGTGCTATTTTACATGAAAAAAAAGGAGATAAGATG
  TGCCCAGGATGTAGTGATCCTGTGCAGCGGATTGAGCAGTGCACACGAGGTTCTCTCTTTATGTGTAGCA
  TTGTTCAAGGATGCAAGAGAACATATCTGTCTCAGAGAGACTTACAAGCTCATATCAACCATCGCCATAT
  GAGAGCTGGAAAGCCCGTTACCCGTGCTTCACTTGAGAATGTTCATCCTCCTATTGCCCCCCCACCAACT
  GACATCCCCGATCGGTTCATAATGCCACCAGACAAGCATCATATGAGCCATATTCCTCCAAAGCAGCACA
  TCATGATGCCACCGCCTCCTCTGCAGCATGTGCCACATGAGCACTATAATCAGCCACATGAGGATATTCG
  TGCTCCTCCGGCAGAATTGTCCATGGCTCCACCTCCACCTCGTTCGTTTACTGAAGACCAAGGAACTCTG
  AGCCCTCCATTTACACAACCAGGAGGAATGAGTCCTGGTATATGGCCTGCACCAAGAGGGCCACCTCCTC
  CTCCACGAATGCAGGGCCCGCCTTCTCAAACCCCACTACCTGGACCGCATCATCCAGATCAAACAAGATA
  CAGACCGTATTACCAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253848
• Insert Size: 999 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001253848.1, NP_001240777.1
• RefSeq Size: 3530 bp
• RefSeq ORF: 999 bp
• Locus ID: 104836
• UniProt ID: Q9JIY2
• Cytogenetics: 12 A2
• Gene Summary: E3 ubiquitin-protein ligase that mediates ubiquitination of several tyrosine-phosphorylated Src substrates, including CDH1, CTTN and DOK1 (PubMed:11836526, PubMed:22252131). Targets CDH1 for endocytosis and degradation (PubMed:11836526). Associated component of the WMM complex, a complex that mediates N6-methyladenosine (m6A) methylation of RNAs, a modification that plays a role in the efficiency of mRNA splicing and RNA processing (PubMed:29535189, PubMed:29547716). Its function in the WMM complex is unknown (PubMed:29535189, PubMed:29547716).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate in-frame splice site and lacks an segment in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.