Hax1 (NM_001282032) Mouse Untagged Clone

CAT#: MC226218

Hax1 (untagged) - Mouse HCLS1 associated X-1 (Hax1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hax1
• Synonyms: HAX-1; Hs1bp1; HSP1BP-1; mHAX-1s; SIG-111; Silg111
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226218 representing NM_001282032
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCGTCTTTGATCTTTTCCGAGGCTTTTTCGGCTTTCCTGGACCTCGGAGCCACAGAGATCCTTTTT
  TTGGAGGGATGACTCGAGATGATGACGACGATGATGATGATGATGACGAAGCGGAGGAAGACAGAGGCGC
  GTGGGGTCGAGAGAGCTATGCGTTTGATGGTTCTCAGCCTCCAGAGGAATTCGGTTTCAGCTTCAGCCCC
  AGGGGAGGGATGCGATTCCACGGCAACTTTGGCTTTGATGATCTATTGGATGATACATGGCCTGTGAGTC
  CCCATTCTAGAGCCAAAGAGGACAAAGATCTTGACTCCCAGGTTTCCCAGGAAGGTCTGGGTCCACTTCT
  TCAACCCCAGCCCAAATCGTATTTCAAAAGTATCTCTGTGACCAAGATCACTAAGCCAGATGGGACAGTG
  GAGGAACGCCGCACTGTGGTAGACAGTGAGGGCCGGAGGGAGACCACAGTGACCCATCAAGAAGCCCATG
  ACAGTTCCAGAAGTGATCCAGACTCTCAGAGATCTTCAGCTTTGGATGATCCCTTTTCCATTCTGGATTT
  GCTACTAGGACGTTGGTTTCGGTCCCGATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282032
• Insert Size: 591 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282032.1, NP_001268961.1
• RefSeq Size: 923 bp
• RefSeq ORF: 591 bp
• Locus ID: 23897
• Cytogenetics: 3 F1
• Gene Summary: Recruits the Arp2/3 complex to the cell cortex and regulates reorganization of the cortical actin cytoskeleton via its interaction with KCNC3 and the Arp2/3 complex. Slows down the rate of inactivation of KCNC3 channels. Promotes GNA13-mediated cell migration. Involved in the clathrin-mediated endocytosis pathway. May be involved in internalization of ABC transporters such as ABCB11. May inhibit CASP9 and CASP3. Promotes cell survival. May regulate intracellular calcium pools.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site and exon in the coding region, but maintains the reading frame compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.