Dbndd2 (NM_001048228) Mouse Untagged Clone

CAT#: MC225977

Dbndd2 (untagged) - Mouse dysbindin (dystrobrevin binding protein 1) domain containing 2 (Dbndd2), transcript variant 3

USD 196.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dbndd2 (NM_001048228) Mouse Untagged Clone
Symbol Dbndd2
Synonyms 1110017A21Rik; 2900022J10Rik; AU041050; AW048677; D2Bwg0891e; Nkip; R74724
Vector pCMV6-Entry
Sequence Data
>MC225977 representing NM_001048228
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCCAAATCCGAGAGCAGCCCTGGAGCGCCAACAGCTGCGGCTCCGGGAGAGGCAGAAGTTCTTTG
AGGACATTTTACAGCCAGAGACAGAGTTTGTCTTCCCCCTGTCCCATCTGCACCTGGAGTCACAAAGACC
CCCCATAGGTAGCATCTCGTCTATGGAAGTGAATGTGGACACACTGGAGCAAGTGGAGTTTATTGATCTT
GCGGATCAGGATGGAGCAGATGTGTTCTTGCCTTGTGAGGAGTCCTCGCCAGCTCCCCAGATGTCTGGAG
TGGATGACCATCCAGAGGAGCTGAGCCTGCTGGTACCCACGTCTGACAGGACCACATCCCGGACCTCCTC
CTTGTCCTCTGACTCCTCCAACCTGCGCAGTCCAAATCCAAGTGATGGGGGAGGAGACACTCCCTTGGCA
CAGTCTGATGAGGAGGACGGGGATGACGGAGGGGCAGAGCCTGGACCCTGCAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001048228
ORF Size 477 bp
Insert Size 477
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001048228.1, NP_001041693
RefSeq Size 3601
RefSeq ORF 477
Locus ID 52840
Cytogenetics 2 H3|2 85.17 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.