Nnat (NM_001291130) Mouse Untagged Clone
CAT#: MC225492
Nnat (untagged) - Mouse neuronatin (Nnat), transcript variant 5
"NM_001291130" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nnat |
Synonyms | 5730414I02Rik; AW107673; Peg5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225492 representing NM_001291130
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGCAGTGGCAGCAGCCTCGGCAGAACTGCTCATCATCGGCTGGTACATCTTCCGCGTGCTGCTGC AGGTGTTCCTGGAATGCTGCATTTACTGGGTGTTCAGGTACTCCCTGCAGAAGCTGGCGCACACGGTGTC CCGGACCGGGCGGCAGGTGCTGGGGGAGCGCAGGCAGCGAGCCCCCAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291130 |
Insert Size | 192 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291130.1, NP_001278059.1 |
RefSeq Size | 1200 bp |
RefSeq ORF | 192 bp |
Locus ID | 18111 |
UniProt ID | Q61979 |
Cytogenetics | 2 H1 |
Gene Summary | May participate in the maintenance of segment identity in the hindbrain and pituitary development, and maturation or maintenance of the overall structure of the nervous system.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) lacks an alternate exon but contains a different exon that results in a frameshift in the 3' coding region, compared to variant 3. The encoded isoform (e) has a distinct C-terminus and is shorter than isoform c. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227703 | Nnat (myc-DDK-tagged) - Mouse neuronatin (Nnat), transcript variant 5 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review