Fhdc1 (NM_001033301) Mouse Untagged Clone

CAT#: MC223750

Fhdc1 (untagged) - Mouse FH2 domain containing 1 (Fhdc1), transcript variant 2, (10ug)

USD 1,463.00


Availability*
7 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fhdc1 (NM_001033301) Mouse Untagged Clone
Symbol Fhdc1
Synonyms 6330505N24Rik; Gm126
Vector pCMV6-Entry
Sequence Data
>MC223750 representing NM_001033301
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATGTTATGAATTGTGTCTCCCTGGCCAGCGATAAAGAAAATGGGACTCTTGCCACAGCAGCTGCAT
TCATGACTGGGCAGACGTCACCCTCTGCATCTCCTCCACCTCCTCCTCCACCGCCTCCACCTCCACCTTG
TCCACATTCAGGGGAGGGCTTTTCCCCCTCCCCTCCTCCTCCTCTGCCACCTCCACTTCCTGGGGGACCT
CCCATACCCCCTCCTCCTCCTCCAGGACTCCCCTCAGTTTCTTACCTGAATGGCTACAGCTCCCTGGGTA
AGAAGAAACGAATGCGGAGCTTTTTCTGGAAAACCATTCCAGAGGAGCAAGTTCGAGGCAAGACCAACAT
CTGGACCTTAGCAGCTAAGCAGCAGCATCAGTACCAGATCGACAAGAAGACCATTGAGGAGCTTTTTGGG
CAGCAAGAAGACACCTCCAAGGCTTCTCTTCCCAAGAGAGGAGGAGCTTTGAATTCATCCTTCAGAGATG
CCCGGGAAGAGGTTACCGTCTTGGATGCAAAGCGAAGTATGAACATTGGCATATTTCTTAAGCAGTTTAA
AAAGTCTCCTCAGTCCATCGTAGAGGATATCTATCAAGGAAAGAGCGAGCATTACGGATCAGAGACGCTT
CGAGAAATCCTTAAGCTTTTGCCGGAGTCAGAAGAGGTAAAGAAATTAAAGGCATTTAATGGCGATGTAT
CCAAGCTCTCGCTGGCAGATTCCTTTCTGCACTGCTTGATTCAGGTGCCAAACTATTCACTTCGGATTGA
AGCCATGGTGCTAAAAAAGGAGTTTTTGCCATCTTGTTCCTCTCTGTTCAAAGACATAAGGACTCTGAGA
GCAGCTACAAAAGAGCTGATGTTATGTGAGGAGCTACATTCAATATTACACTTGGTGCTCCAGGCTGGGA
ATATCATGAATGCCGGAGGGTATGCCGGCAATGCCGTAGGATTTAAACTGTCTTCTCTACTCAAATTGGC
GGACACGAAGGCAAACAAACCTGGAATGAATCTTCTGCATTTTGTAGCTCAGGAAGCCCAGAAGCAAGAT
GCCATCCTTCTAAACTTCTCTGAGAAGTTGCAGCACGTGCAAGAGACATCGAGATTATCTCTGGATATCA
CCGAGGCAGAGCTGCACTCTCTCTTTGTCAGAACGAAATCGCTGCAGGAAAACATCCAGCTTGACCAGGA
GCTGTGCCAGCAGATGGAAGACTTCCTCCAGTTTGCTGTGGAGAAGTTGGCGGAGCTGGAACTCTGGAAA
CGGGAGCTGCAGGGTGAAGCTCACACCCTTATAGACTTTTTCTGCGAAGACAAAGAAACCATGAAACTGG
ATGAATGCTTCCAGATATTCAGAGACTTCTGTACCAGATTCAACAAAGCAGTTAAGGACAATCATGACCG
GGAGGAACAGGAGCGGAAGCAGCTACAGAGGCAGAAGGAGATGGAACAGAAGCGGTATTCCTGGTCAACT
GGGGAACTCGGGAGCTTTGGCAGGAGCAGCAGTGAGAATGATGTGCAGATGCTAGCTAAGACAGGCACAG
AAGACCTGCCCTCCTTCCTGAAGCCCAGGCCCAACAGCCCCTCCTACCGGCCCCCCAACACACGTCGCTC
CCGCCTCTCCCTGGGCATCTCTGCGGACCGGGAGCTTTTGACCTTCCTGGAGAGTGCCACCAGCAGTCCA
GAGGACCCCAACAAATTCAACAGTTTGCCCCGGAGCAGTCCCCGACAAGCTCGGCCCACCATCGCCTGGA
TGGAACCCAGAGAACAACAGAGCCATGGCCCTAACTTTACACATGAACCTCAGGCCTCAAAGATCCAGGA
GAAAGCCCCTCCCCCTGCTTGGCAAAATCAGCTTCCGACAACCTGGCGGGAGGAGCCTGCTTCTCCCCTC
CCACTGGCTGGGCGGAGCAGGCCGAGCCTCCGAAAAAGGAACAGTGAACCTGTGGGCTTGGGTCCCACAC
AAAGCCCTCCACTCTTACCATTGGATCTGGGTGTTAGGGAGCATGAGTTGGTCACAGGGCTGACCCAGTT
TGACCTCCAGAGTCCCAAGAGCCTGGAGGAAGGATCCCAACTGACTCTGAATGACTTCTGTCCCACAAAG
CTGCCATCTCCAGGGGATAGGAGCTCACAGCCCTTTGCTGCTGGCGGTGACAGTCTCCCACCCAAGGACA
CAGACACCCAGGAGGTTCTCAGCCCAGCTGGGGAGGATGACAGGACCATCTCTGATGAACCCAGCAGTGA
GGCTCTCGTGTCTGTGGTTGTCACCGACACTGAAGATAAGGATGCTGGACCTCTGTTATATGTCTCAGAT
ACCACAGACTGCTCACTGACTCTGGACTGCTCCGAGGGAATGGACTCCAGAGCCGGGGGAGACAAGCAAG
AGGAAGAGAAGGAAGGGGATGGCTCAGTGTCCTCTGGGGCTGGAGAGGCAGGAAGCAGCCAGGTTTCCTC
CAACTCTGTTTCCAGCCCCCCTGGGGAGGTTCCTGCTCCAAAATCCAGTAAGAGTGAGCTGAGCTGCCAA
GGTGGCCTTCCGAAGGACAGACCCAGCAGAGGGAAGGATGCTATAGCACCAAAGAGAAATTCCTTCAAAG
AGGCTTCAGTAGGGGCTTCAAAGCCTGTCAGTGCACGGCGCAGCCAAGGGGTAACAACCAAGCCTGTGCG
AACCTTGAACTCCTCCGAGAACGAACATATGCGCAAAGTGGTCCCTATCTCCAAGTCCAGCAGGGGAGCC
GGGCCCTGGAAGCGGCCGGAACCGACACCCAAGGCTACCCCTCGGGAGACACCCAGCAGCACAGACACAC
CACTATCACGAAGGAGCTCAGTGAGAGGAACTTCGGACACTTCGCCCAGGAGGCCCCAGGTGAGTGGATC
TGGGGCAGAGGAGCCCAGGCTGCCCCGCTCGAGTGGCAGCATCAGTGGACGGCCAGGGAAGGACGCCCCG
CTGCAGCCCAGAGCCTCGTTCAGGAAGCCTAGCGCCAAGCCCCTCAGAAACATCCCCAGGCAGAAACCTG
AAGAAAACAAGGTCAGCAGCCCCAACTCTCCTGACCCCGAGAGTCCCAAGGAAGAGCCCAAGGCTCCTCA
GGCTACGGGTGTCTCTCGAGCCCTTCCCCCCATCCCAAGTTTTGCTCGAAATACGGTGGCCTCGTCATCT
CGGAGCCTGCGAACGGATGCTCCACCCGCGGCCAGAACCACTGGCCTCACCAGGACAGTCTCCCAGCGGC
AGCTTAGGGTCAAAGGTGGCTCCGAGGATTCTGCCTCCAAGGACATTGGCACTTTGAAGAGGGCCAGCAG
TGCTCGGGCCTCCAAGAAGTGTCCTGAATCTGCTGGGGGTTCAAGTGCCAATGTAGAAACCTCACTGAAG
GGCAGAGGGACGACGGAAAGATCCTCTCTCAGACTGAAGGACTCGGGGCAGGCCACCCTCGGGAGGATCC
TCCGTCCCCTGCAGAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001033301
ORF Size 3450 bp
Insert Size 3450
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001033301.4, NP_001028473
RefSeq Size 5930
RefSeq ORF 3450
Locus ID 229474
Cytogenetics 3|3 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.