Itga7 (NM_008398) Mouse Untagged Clone

CAT#: MC223683

Itga7 (untagged) - Mouse integrin alpha 7 (Itga7), (10ug)

USD 1,442


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Itga7 (NM_008398) Mouse Untagged Clone
Symbol Itga7
Synonyms alpha7; [a]7
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC223683 representing NM_008398
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGGATTCCGAGGTGCGATTTTCTCCGGCCCCCCGGAATCTACTATCTTATTACTTCCTTGCTCG
CTGGACTGTTCTTACCACCGGCTATCGCCTTCAATCTGGATGTGATGGGTGCCATACGCAAGGAGGGAGA
ACCCGGCAGCCTATTCGGCTTTTCGGTGGCCCTGCACCGACAATTACAGCCCCGACCCCAGAGCTGGCTG
CTGGTGGGCGCTCCCCAGGCCCTGGCTCTTCCTGGACAGCAGGCAAACCGCACCGGAGGCCTCTTTGCTT
GTCCCCTGAGCCTAGAGGAGACAGATTGCTACAGAGTGGACATTGACAGGGGAGCTAACGTGCAGAAGGA
GAGCAAGGAGAACCAATGGCTGGGAGTCAGTGTCCGGAGCCAGGGGCCAGGGGGCAAGATTGTTACGTGT
GCACACCGATATGAGTCTCGACAGAGAGTGGACCAGGCTTTGGAGACTCGGGATGTGATTGGCCGCTGCT
TTGTGCTAAGCCAGGACCTGGCCATCCGTGATGAGCTGGATGGTGGGGAGTGGAAGTTCTGTGAGGGGCG
CCCCCAGGGCCATGAACAGTTTGGGTTCTGTCAGCAGGGCACAGCTGCCACCTTCTCCCCTGACAGTCAC
TACCTCGTCTTTGGGGCTCCAGGAACCTATAACTGGAAGGGGTTGCTTTTTGTGACCAACATTGATAGCT
CAGACCCTGACCAGCTGGTGTATAAAACTTTGGACCCTGCTGACCGGCTCACAGGACCAGCCGGAGACTT
GACCTTGAATAGCTATTTAGGTTTCTCCATCGATTCTGGGAAGGGTCTTATGCGCTCAGAAGAGCTGAGT
TTTGTGGCAGGGGCCCCACGTGCCAACCACAAAGGGGCTGTGGTCATTCTGCGCAAGGATAGCGCCAGCC
GCTTGATACCTGAGGTTGTGCTGTCTGGGGAGCGCCTGACCTCTGGCTTTGGCTACTCACTGGCTGTGAC
TGATCTCAACAATGATGGCTGGGCAGACCTGATTGTGGGTGCCCCCTACTTCTTTGAACGCCAAGAAGAG
CTGGGAGGTGCTGTGTATGTGTACATGAACCAGGGTGGCCATTGGGCAGATATCTCTCCTCTCCGAATCT
GTGGCTCCCCTGATTCCATGTTTGGGATCAGTTTGGCTGTATTGGGGGACCTCAACCAAGATGGCTTCCC
AGACATTGCCGTGGGAGCTCCCTTTGACGGAGATGGGAAGGTCTTTATCTACCATGGGAGCAGCCTTGGG
GTGGTTGTCAAACCTTCACAGGTGCTGGAGGGCGAGGCGGTGGGTATCAAGAGCTTTGGTTACTCCCTGT
CTGGTGGCCTGGATGTGGATGGAAATCACTACCCAGACCTGCTTGTGGGCTCCCTGGCTGATACCGCTGC
TCTGTTCAGGGCCAGACCTGTTCTACATGTCTCCCAAGAGATCTTCATTGACCCCAGAGCCATCGATCTG
GAACAACCCAACTGTGCCGATGGACGCTTGGTCTGTGTGGACATAAAGATCTGTTTCAGCTATGTCGCTG
TGCCCAGCAGCTACAGCCCTAGTGTGGCCTTAGATTATATGTTAGATGGGGACACAGACCGGAGGCTCCG
GGGCCAGGTTCCACGTGTGACGTTTCTGAGCCGAGGCCTGGATGACCTCAGGCATCAGTCCTCCGGCACC
GTGTGGCTGAAGCACCAACATGACCGAGTCTGTGGAGATACTGTGTTCCAGCTGCAGGAAAACGTCAAAG
ACAAGCTACGGGCCATTGTGGTGACCCTGTCATATGGTCTCCGAACCCCTCCATTAGGGAGGCAAGCACC
TGGCCAGGAGCTCCCCACTGTGGCTCCCATCCTCAATGCTCACCAGCCCAGCACCCAGAGGACTGAGATC
CACTTTCTGAAGCAAGGCTGCGGTGAAGATAAGATCTGTCAGAGCAACCTCCAGCTCGAGCGGTACCAGT
TCTGTTCCAGGATCAGCGACACAGAGTTCCAGGCTCTGCCCATGGATCTGGATGGAAGGACCGCCCTGTT
CGCATTGAGTGGGCAGCCGTTCATAGGCCTGGAACTGACAGTCACCAACCTGCCCTCTGACCCTGCCCGG
CCTCAGGCAGATGGGGATGATGCTCATGAAGCACAGCTCTTGGTCACTCTCCCAGCCTCTCTACGGTACT
CAGGAGTCCGTGCTCTGGACTCTGTGGAGAAGCCGCTCTGCCTGTCCAATGACAGCGCCTCTCATGTCGA
GTGTGAGCTGGGGAACCCTATGAAGAGAGGCGCTCAGGTCACTTTTTACCTCATCCTCAGCACCTCTGGG
ATCACTATTGAGACCACAGAGCTGGAGGTGAAATTGCTGTTAGCCACGATCAGTGAGCAGGAGCTGGATC
CGGTCTCCGTTCGGGCTCATGTCTTCATTGAATTGCCACTGTCCATTTCAGGGGTGGCCACTCCCCAGCA
ACTCTTCTTCTCTGGCGAGGTGAAGGGCGAAAGTGCCATGCGATCTGAGAGGGACGTGGGCAGCAAAGTC
AAGTATGAGGTCACGGTCTCCAATCAAGGCCAGTCTCTCAATACTCTGGGCTCTGCGTTCCTCAACATCA
TGTGGCCCCACGAGATCGCCAATGGAAAGTGGCTGCTGTACCCCATGCGGGTAGAGCTGGAGGGCGGACA
GGGGCCTGGCAAGAGAGGGATCTGTTCCCCAAGACCCAACATCCTCCAGCTGGATGTGGACAGCAGGGAT
AGGAGGCGGCGAGAGCTGGGGCAGCCGGAGCCGCAGGAGCCTCCAGAGAAGGTGGAGCCTAGCACATCCT
GGTGGCCAGTGTCCTCTGCTGAGAAGAGAAACGTGACTCTGGACTGCGCCCAGGGCACGGCCAAGTGTGT
GGTGTTCAGCTGCCCACTCTACAGCTTTGATCGTGCAGCCGTGCTTCACGTCTGGGGCCGCCTCTGGAAC
AGCACCTTTCTGGAGGAGTACATGGCCGTGAAATCCCTGGAAGTGATCGTCCGAGCCAACATCACAGTGA
AATCCTCCATTAAGAACTTGTTGCTCAGAGATGCATCCACAGTGATTCCAGTGATGGTGTACTTGGACCC
CATGGCCGTGGTTGTGGAAGGAGTCCCCTGGTGGGTCATCCTCCTGGCAGTGCTGGCTGGGCTGTTAGTC
CTGGCCTTGCTGGTACTGCTGCTGTGGAAGCTGGGATTCTTCAAGCGGGCGAAGCACCCCGAGGCCACCG
TGCCCCAGTACCACGCAGTGAAGATCCCTCGGGAAGACCGACAGCAGTTCAAGGAGGAGAAGACAGGCAC
CATCCAGAGGAGTAACTGGGGCAACTCCCAGTGGGAGGGCTCCGACGCACACCCCATCTTGGCTGCCGAC
TGGCATCCTGAGCTGGGTCCTGATGGACATCCGGTGCCAGCCACTGCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008398
ORF Size 3411 bp
Insert Size 3411
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008398.2, NP_032424
RefSeq Size 4035
RefSeq ORF 3411
Locus ID 16404
Cytogenetics 10 D3|10 77.2 cM
Gene Summary This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.