Rps6kc1 (NM_178775) Mouse Untagged Clone

CAT#: MC223404

Rps6kc1 (untagged) - Mouse ribosomal protein S6 kinase polypeptide 1 (Rps6kc1), (10ug)

USD 1,350.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rps6kc1 (NM_178775) Mouse Untagged Clone
Symbol Rps6kc1
Synonyms AA682037; B130003F20Rik; C80612; Rpk118
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC223404 representing NM_178775
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCTCTCCTTGGGGTCACAGTGCGGACCTGGCCCGCTTCTACACTGTCACCGAGCCCCAGCGACACC
CCAGGGGCTACACTGTCTATAAGGTTACCGCACGGGTTGTTTCACGGAGAAATCCAGAGGACGTCCAGGA
GATAATTGTGTGGAGGAGATACAGTGACTTCAAGAAACTGCACAGAGAATTATGGCAAATTCACAGGAAT
GCATTTCGACACTCTGAGCTATTTCCCCCGTTTGCTAAAGGGACAGTGTTTGGGCGGTTCGACAAGACGG
TGATTGAGGAGCGACGGCAGTGTGCTGAGGACCTGCTGCAGTTCTCTGCCAACATCCCCGCCCTGTACAA
CAGCAGGCAGCTCCAGGACTTCTTCAAGGGTGGGGTAATTAGTGATGGCTCTGAGTTAATTGGCCCTGCT
GAAGCTTACCCAGACTCCCCGGCCAACGCCTTTCCTGAGTGCGGTACTGAAGGATTCTCCAGTGACAGTG
ACCTTCTGTCCCTCACTGTTGATGCAGACTCTCTTGCCGAGGTAGATGATGGAATGGCTTCCCGTCAGGG
TTCTCCCAGTAGAACCTTTGGTCTGAGTCTGTCTACGGATTCTTCGGCAGTAGGGGCTGTTGCTTCTGAC
AGTGAACCAAGCAGAGTAGAAGACCGGGAAAGCCGCAGCCTCTTCCCCAGCAGCTTAAAGCCAAGGCTTG
GCAGGAGAGATTACCTGGAGAAGGCAGGGGAACTTATCAAACTGGCCTTAAAGAAGGAGGAGGAAGATGA
CTATGAAGCTGCTTCTGACTTTTACAGGAAGGGCGTCGATCTGCTCCTAGAAGGTGTACAAGGAGAGTCG
AGCCCCACGCGTCGGGAGGCTGTGAAGAGAAGGACTGCGGAGTACCTCATGCGTGCAGAGAGCATCTGTA
GCCTCCGGGCCGCGCCTCAGCTCCACACGGGACCACAGCCTCCAGGATCACTAAGTTCAAGGCCCCCTTG
GAGCCTGAGGAGCCCTGCCGAGGAGCTGAAGGCCTTCCGAGTCCTTGGGGTGATTGACAAGGTTTTACTT
GTAATGGATACAAGGACAGAGCAGACATTCATTTTAAAAGGTCTAAGGAAAAGCAGCGAGTGCAGCAGGA
ACAGAAAGACCATCATCCCCCGCTGTGTGCCTAACATGGTGTGTCTGCACACGTACATCATCTCGGAGGA
ATCGGTGTTTCTCGTGCTGCAGCGCGCCGAAGGTGGAAAACTCTGGTCGTATATCAGTAAATTTCTGAAC
AGAAGCTCTCAGGAAAGCTTGGACATTAAGGAAGGGAGACCGTCCATGCCTCCTCGAGTGTGCCTGCAGC
AGCCAAGTGCCAGTCCCCAGGGCGGCAGCAGCTTCGAGTCCAGAGGGAGCGACACGGGGAGCATGCTGAA
GGCTCTGCCTCTGAAGACCAGTCTCACCCCGAGTTCTCAAGACGACAGCAACCAGGAAGACGACGGCCAG
CCCAGCTCTCCCAAGTGGCTGGATTCGGGCTCCAGTTCAGAGGATGAGTGCACAGCGGGCTACCTGACGC
TGTGCAACGAGTATGGGCAAGAAAAGATGGACCTGGTGTCTCTGAGCGAGGAGTCTGTTATGCAGCCTGA
AGGGGACAAGGCTGACACCCAGGCGGTTAGTTCCCCAGCATCCCTCGCCACTGGCAGTGTGAGCCCTAGC
ACCCACCTCAGGGTCTTCTCTGGAGGTGAGGATCTAGAGGCGGTTTCTTCTCCTCCAACATCTGAATCCC
TCAGTAGGTCAAAAAACAGCCCTATGGAATTCTTCAGAATAGACAGTAAAGACAGCACAAGTGAGCTCCT
GGGACTGGATTTTGGTGAGAAATTACACAGTCTGAAACCAGAGCCTTTGAAAGCCCTCTTTACCCTTGAA
GATGGAGACAGCCCTTCTCAGAGTCTTGATCCTGGTGAGAGCAAGAGAGAGAGTGAAGCTCAGGACTCCG
TGAGCCGGGGCTCAGATGATTCCGTCCCAGTTATCTCATTTAAAGAGGCGGCTGCAGAGGCTATCAGTGG
GGCTGAGGAGGGAAGGCCTGACCTTCTTGTGAATTTACCTGGGGAACTGCAGCCAACCAAAGAGGCTTCA
GCAATGGACCCTAAGTTTTCACAGGCCAGTGCAGGCAGGCTGGATAGTAAACTGCTGGAAGCCCCGGATG
TGTTGTGCCTCAGGCTGAGTTCTGAACAGTGCCATGGTCTGGGACCAGAAGGCCCAGAGGAACTGAGCGA
TCCCACTGAATTCTGTCCCGGAGGTGTGATCCCAGAGCACGATGCTCAGGCAGATCCCGGGGTGCTATTC
GAGGCTGCCGTTGATCACAGGAGCTCCCCAGACCAGTTTCTGTTTTCCAGCTTGCGTTCCGAGTCTGACA
GGCTGGGGCAGGTGGAGGTAGTGGTCACTGCACAGGCCTTGCAAGAAAGCCTGTTCCACATTTCTAGTCC
CTGCTCAGGTGCTAATAAAGAACACAGTGCATACGCCGACACTGCCACGTCGGAGGAGGTGTTGCTGTTC
ACAGAACCGACTAAAGAAGAAGCGAACTCTCTGTTCCAGAGAGACTCGGAGGCCCAGGAGCGAGGTGTGG
GAGCCGGGGAAGCAGACAAGGAAATCCATCAGATCTTTGAGGACCTGGATAAACGACTAGCAGCTAGCTC
CAGGTTCTTCATCCCAGAGGGCTGCATTCAGAGATGGGCAGCGGAAATGGTGGTAGCCCTTGACGCCTTG
CACAGAGAGGGGATTGTGTGCCGAGATCTGAACCCAAACAACATCTTATTGAATGATGGAGGACACATTC
AGCTAACGTATTTTAGCAGGTGGAGTGAGGTTGAAGATTCCTGCGACAGCGATGCCGTAGCGAGAATGTA
CTGTGCCCCAGAGGTTGGAGCAGTCACAGAAGAAACTGAAGCCTGTGATTGGTGGAGCCTGGGTGCTGTC
CTCTTCGAACTTCTCACTGGCAAGACGTTGGTGGAATGCCACCCAGCCGGAATAAATACCCACACTACTT
TGAACATGCCAGGTTGTGTTTCTGAAGAGGCTCGCTCACTCATCCAACAGCTCCTGCAGTTCAACCCTAT
GGAGCGCCTGGGTGCTGGAGTGGCTGGTGTTGAAGATATCAAATCTCACCCGTTTTTCACCCCTGTGGAT
TGGGCAGAGTTGACAAGATGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_178775
ORF Size 3171 bp
Insert Size 3171
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_178775.4, NP_848890
RefSeq Size 4034
RefSeq ORF 3171
Locus ID 320119
Cytogenetics 1|1 H6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.