Epb41 (NM_001128606) Mouse Untagged Clone

CAT#: MC221783

Epb4.1 (untagged) - Mouse erythrocyte protein band 4.1 (Epb4.1), transcript variant 2, (10ug)

USD 1,030.00


Availability*
6 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Epb41 (NM_001128606) Mouse Untagged Clone
Symbol Epb41
Synonyms 4.1R; AI415518; D4Ertd442e; Elp-1; Elp1; Epb4.1; mKIAA4056
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC221783 representing NM_001128606
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAACAGAGAAGAGTTTAGCGGCTGAAGCTGAGAATTCTCAGCACCAGCAACAGAAGGAAGAAGGAG
AGGGAGCCACAAACTCAGGCCAACAAGAAACTCAGCTGGAGGAGGCCTCCCAAGCGGCCGCAGCTGAGGG
CAGCGATCAGGGTGAGCAGAAGCTGAAAGCATCCAATGGGGACACTCCAACACATGAAGACTTGACCAAG
AACAAGGAACGGACATCAGAAAGCAGAGGCCTGTCACGACTGCTCTCCTCATTCCTCAAAAGGCCCAAGT
CGCAGGTCTCTGAAGAAGAAGGCAGAGAAGTAGAATCAGAGAAAGAGAAAGGTGAAGGGGGTCAGAAGGA
GATAGAACTTGGAAACAGCCTTGATGAAGACATCATTTTAAAGGCCCCCATTGCAGCTCCTGAACCTGAG
CTCAAAACAGACCCATCTTTGGATCTTCATTCATTAAGCAGTATAGAGACACAGCCAGCTCAGGAAGAAC
ACAGAGAGGACCCAGATTCTGAAACGAAGGAAGGAGAAGGGATTGAAGAGTGCTCTGGAACAGAGGTGAA
AGAGGACCCAGAGTCAAGAGCAGAGAGAGAACCCGAAGCCTCCCAGAAGCCCGTCAGAAGACACAGAAAC
ATGCACTGTAAGGTCTCCTTGTTGGATGACACGGTCTACGAATGTGTTGTAGAGAAACATGCTAAGGGAC
AAGACTTGCTGAAGCGAGTGTGCGAGCACCTCAACCTTTTGGAAGAAGACTACTTTGGTTTAGCCCTGTG
GGACAGCGCAACCTCTAAGACATGGCTGGATTCTGCCAAAGAAATAAAAAAGCAGGTTCGAGGTGTTCCT
TGGAATTTCACATTTAATGTGAAGTTTTATCCACCCGACCCAGCACAATTAACAGAAGACATAACAAGAT
ACTATTTATGTCTTCAGCTTCGGCAGGACATTGTTGCTGGACGTCTGCCCTGTTCCTTTGCAACTTTAGC
CCTACTCGGGTCTTACACGATCCAGTCTGAGCTGGGAGACTATGACCCAGAACTGCACGGCATGGATTAT
GTTAGTGATTTTAAACTGGCTCCAAATCAGACCAAGGAACTTGAAGAAAAGGTCATGGAATTGCATAAAT
CATACAGGTCCATGACTCCAGCTCAGGCTGACTTGGAATTTCTTGAGAATGCCAAAAAGTTGTCCATGTA
TGGAGTTGATCTTCACAAAGCAAAGGACTTGGAGGGAGTGGACATTATTCTCGGCGTCTGCTCCAGCGGC
CTTCTGGTTTACAAAGACAAGTTGAGAATTAACCGCTTTCCTTGGCCCAAAGTGCTAAAGATTTCTTACA
AACGCAGCAGCTTCTTCATCAAGATCCGGCCTGGAGAGCAAGAACATTATGAAAGTACCATCGGCTTCAA
GCTCCCCAGTTATCGAGCGGCCAAGAAACTATGGAAGGTCTGTGTGGAGCATCACACGTTCTTCAGACTC
ACCTCTACAGACACCATCCCCAAAAGCAAGTTTCTTGCCCTGGGATCCAAATTCCGATACAGTGGCCGGA
CTCAAGCTCAGACCAGGCAAGCCAGTGCCCTGATTGACAGGCCTGCTCCACACTTTGAGCGGACAGCAAG
CAAGCGGGCGTCCAGGAGCCTCGATGGAGCAGCAGCTGCTGAGTCCACAGACCGAAGTCCTCGGCCCACC
TCTGCCCCAGCCATTGCTCAGAGTCAGGTCACAGAAGGGCCAGGGGCACCTATCAAAAAAACACCAAAGG
AAGCTGTGAAGGTTGAAGAGAAGCGGGGAGAAGAGCCGGCTGAGCCCGCTGAGCCGGAGCCCACAGAAGC
ATGGAAGGATTTAGACAAGAGTCAAGAAGAGATCAAAAAGCACCATGCCAGCATCAGTGAACTGAAAAAG
AACTTTATGGAATCGGTACCCGAACCACGGCCCAGCGAGTGGGACAAGCGCTTATCTACACACTCACCCT
TCCGGACTCTTAACATCAACGGGCAAGTCCCTACTGGAGATGGACCTCCTCTGGTAAAGACTCAAACTGT
CACCATCTCAGATACTGCCAATGCTGTGAAAAGTGAAATCCCAACCAAAGATGTCCCTATTGTCCACACT
GAGACCAAGACCATCACCTATGAAGCTGCCCAGACTGAGGACAGCAATGGGGACTTAGACCCTGGAGTCT
TGCTGACAGCCCAGACCATCACATCCGAGACCACAAGTAGTACAACCACGACACAGATTACCAAGACTGT
AAAAGGTGGGATTTCTGAGACCCGGATCGAGAAGAGAATTGTGATCACAGGAGATGCCGATATCGACCAT
GATCAGGTCCTTGTACAAGCCATCAAGGAAGCCAAGGAGCAGCATCCAGACATGTCAGTGACCAAGGTGG
TCGTCCACCAGGAGACAGAGATCTCTGAGGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001128606
ORF Size 2415 bp
Insert Size 2415
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001128606.1, NP_001122078
RefSeq Size 5141
RefSeq ORF 2415
Locus ID 269587
Cytogenetics 4 D2.3|4 64.54 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.