Epb41 (NM_001128606) Mouse Untagged Clone

CAT#: MC221783

Reviews ()
Write a review

Epb4.1 (untagged) - Mouse erythrocyte protein band 4.1 (Epb4.1), transcript variant 2, (10ug)

  View "NM_001128606" in other vectors (6)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 1,060.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Epb41 (NM_001128606) Mouse Untagged Clone
Type Mouse Untagged Clone
Tag Tag Free
Symbol Epb41
Synonyms 4.1R; AI415518; D4Ertd442e; Elp-1; Elp1; Epb4.1; mKIAA4056
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC221783 representing NM_001128606
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAACAGAGAAGAGTTTAGCGGCTGAAGCTGAGAATTCTCAGCACCAGCAACAGAAGGAAGAAGGAG
AGGGAGCCACAAACTCAGGCCAACAAGAAACTCAGCTGGAGGAGGCCTCCCAAGCGGCCGCAGCTGAGGG
CAGCGATCAGGGTGAGCAGAAGCTGAAAGCATCCAATGGGGACACTCCAACACATGAAGACTTGACCAAG
AACAAGGAACGGACATCAGAAAGCAGAGGCCTGTCACGACTGCTCTCCTCATTCCTCAAAAGGCCCAAGT
CGCAGGTCTCTGAAGAAGAAGGCAGAGAAGTAGAATCAGAGAAAGAGAAAGGTGAAGGGGGTCAGAAGGA
GATAGAACTTGGAAACAGCCTTGATGAAGACATCATTTTAAAGGCCCCCATTGCAGCTCCTGAACCTGAG
CTCAAAACAGACCCATCTTTGGATCTTCATTCATTAAGCAGTATAGAGACACAGCCAGCTCAGGAAGAAC
ACAGAGAGGACCCAGATTCTGAAACGAAGGAAGGAGAAGGGATTGAAGAGTGCTCTGGAACAGAGGTGAA
AGAGGACCCAGAGTCAAGAGCAGAGAGAGAACCCGAAGCCTCCCAGAAGCCCGTCAGAAGACACAGAAAC
ATGCACTGTAAGGTCTCCTTGTTGGATGACACGGTCTACGAATGTGTTGTAGAGAAACATGCTAAGGGAC
AAGACTTGCTGAAGCGAGTGTGCGAGCACCTCAACCTTTTGGAAGAAGACTACTTTGGTTTAGCCCTGTG
GGACAGCGCAACCTCTAAGACATGGCTGGATTCTGCCAAAGAAATAAAAAAGCAGGTTCGAGGTGTTCCT
TGGAATTTCACATTTAATGTGAAGTTTTATCCACCCGACCCAGCACAATTAACAGAAGACATAACAAGAT
ACTATTTATGTCTTCAGCTTCGGCAGGACATTGTTGCTGGACGTCTGCCCTGTTCCTTTGCAACTTTAGC
CCTACTCGGGTCTTACACGATCCAGTCTGAGCTGGGAGACTATGACCCAGAACTGCACGGCATGGATTAT
GTTAGTGATTTTAAACTGGCTCCAAATCAGACCAAGGAACTTGAAGAAAAGGTCATGGAATTGCATAAAT
CATACAGGTCCATGACTCCAGCTCAGGCTGACTTGGAATTTCTTGAGAATGCCAAAAAGTTGTCCATGTA
TGGAGTTGATCTTCACAAAGCAAAGGACTTGGAGGGAGTGGACATTATTCTCGGCGTCTGCTCCAGCGGC
CTTCTGGTTTACAAAGACAAGTTGAGAATTAACCGCTTTCCTTGGCCCAAAGTGCTAAAGATTTCTTACA
AACGCAGCAGCTTCTTCATCAAGATCCGGCCTGGAGAGCAAGAACATTATGAAAGTACCATCGGCTTCAA
GCTCCCCAGTTATCGAGCGGCCAAGAAACTATGGAAGGTCTGTGTGGAGCATCACACGTTCTTCAGACTC
ACCTCTACAGACACCATCCCCAAAAGCAAGTTTCTTGCCCTGGGATCCAAATTCCGATACAGTGGCCGGA
CTCAAGCTCAGACCAGGCAAGCCAGTGCCCTGATTGACAGGCCTGCTCCACACTTTGAGCGGACAGCAAG
CAAGCGGGCGTCCAGGAGCCTCGATGGAGCAGCAGCTGCTGAGTCCACAGACCGAAGTCCTCGGCCCACC
TCTGCCCCAGCCATTGCTCAGAGTCAGGTCACAGAAGGGCCAGGGGCACCTATCAAAAAAACACCAAAGG
AAGCTGTGAAGGTTGAAGAGAAGCGGGGAGAAGAGCCGGCTGAGCCCGCTGAGCCGGAGCCCACAGAAGC
ATGGAAGGATTTAGACAAGAGTCAAGAAGAGATCAAAAAGCACCATGCCAGCATCAGTGAACTGAAAAAG
AACTTTATGGAATCGGTACCCGAACCACGGCCCAGCGAGTGGGACAAGCGCTTATCTACACACTCACCCT
TCCGGACTCTTAACATCAACGGGCAAGTCCCTACTGGAGATGGACCTCCTCTGGTAAAGACTCAAACTGT
CACCATCTCAGATACTGCCAATGCTGTGAAAAGTGAAATCCCAACCAAAGATGTCCCTATTGTCCACACT
GAGACCAAGACCATCACCTATGAAGCTGCCCAGACTGAGGACAGCAATGGGGACTTAGACCCTGGAGTCT
TGCTGACAGCCCAGACCATCACATCCGAGACCACAAGTAGTACAACCACGACACAGATTACCAAGACTGT
AAAAGGTGGGATTTCTGAGACCCGGATCGAGAAGAGAATTGTGATCACAGGAGATGCCGATATCGACCAT
GATCAGGTCCTTGTACAAGCCATCAAGGAAGCCAAGGAGCAGCATCCAGACATGTCAGTGACCAAGGTGG
TCGTCCACCAGGAGACAGAGATCTCTGAGGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001128606
ORF Size 2415 bp
Insert Size 2415
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001128606.1, NP_001122078.1
RefSeq Size 5141
RefSeq ORF 2415
Locus ID 269587
Cytogenetics 4 64.54 cM

Other Versions

Other products for "Epb41"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones