Ace2 (NM_001130513) Mouse Untagged Clone

CAT#: MC221763

Reviews ()
Write a review

Ace2 (untagged) - Mouse angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 (Ace2), transcript variant 1, (10ug)



  "NM_001130513" in other vectors (3)

Reconstitution Protocol

USD 1,232.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ace2
Synonyms 2010305L05Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC221763 representing NM_001130513
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCAGCTCCTCCTGGCTCCTTCTCAGCCTTGTTGCTGTTACTACTGCTCAGTCCCTCACCGAGGAAA
ATGCCAAGACATTTTTAAACAACTTTAATCAGGAAGCTGAAGACCTGTCTTATCAAAGTTCACTTGCTTC
TTGGAATTATAATACTAACATTACTGAAGAAAATGCCCAAAAGATGAGTGAGGCTGCAGCCAAATGGTCT
GCCTTTTATGAAGAACAGTCTAAGACTGCCCAAAGTTTCTCACTACAAGAAATCCAGACTCCGATCATCA
AGCGTCAACTACAGGCCCTTCAGCAAAGTGGGTCTTCAGCACTCTCAGCAGACAAGAACAAACAGTTGAA
CACAATTCTGAACACCATGAGCACCATTTACAGTACTGGAAAAGTTTGCAACCCAAAGAACCCACAAGAA
TGCTTATTACTTGAGCCAGGATTGGATGAAATAATGGCGACAAGCACAGACTACAACTCTAGGCTCTGGG
CATGGGAGGGCTGGAGGGCTGAGGTTGGCAAGCAGCTGAGGCCGTTGTATGAAGAGTATGTGGTCCTGAA
AAACGAGATGGCAAGAGCAAACAATTATAACGACTATGGGGATTATTGGAGAGGGGACTATGAAGCAGAG
GGAGCAGATGGCTACAACTATAACCGTAACCAGTTGATTGAAGATGTAGAACGTACCTTCGCAGAGATCA
AGCCATTGTATGAGCATCTTCATGCCTATGTGAGGAGGAAGTTGATGGATACCTACCCTTCCTACATCAG
CCCCACTGGATGCCTCCCTGCCCATTTGCTTGGTGATATGTGGGGTAGATTTTGGACAAATCTGTACCCT
TTGACTGTTCCCTTTGCACAGAAACCAAACATAGATGTTACTGATGCAATGATGAATCAGGGCTGGGATG
CAGAAAGGATATTTCAAGAGGCAGAGAAATTCTTTGTTTCTGTTGGCCTTCCTCATATGACTCAAGGATT
CTGGGCAAACTCTATGCTGACTGAGCCAGCAGATGGCCGGAAAGTTGTCTGCCACCCCACAGCTTGGGAT
CTGGGACACGGAGACTTCAGAATCAAGATGTGTACAAAGGTCACAATGGACAACTTCTTGACAGCCCATC
ACGAGATGGGACACATCCAATATGACATGGCATATGCCAGGCAACCTTTCCTGCTAAGAAACGGAGCCAA
TGAAGGGTTCCATGAAGCTGTTGGAGAAATCATGTCACTTTCTGCAGCTACCCCCAAGCATCTGAAATCC
ATTGGTCTTCTGCCATCCGATTTTCAAGAAGATAGCGAAACAGAGATAAACTTCCTACTGAAACAGGCAT
TGACAATTGTTGGAACACTACCGTTTACTTACATGTTAGAGAAGTGGAGGTGGATGGTCTTTCGGGGTGA
AATTCCCAAAGAGCAGTGGATGAAAAAGTGGTGGGAGATGAAGCGGGAGATCGTTGGTGTGGTGGAGCCT
CTGCCTCATGATGAAACATACTGTGACCCTGCATCTCTGTTCCATGTTTCTAATGATTACTCATTCATTC
GATATTACACAAGGACCATTTACCAATTCCAGTTTCAAGAAGCTCTTTGTCAAGCAGCTAAGTATAATGG
TTCTCTGCACAAATGTGACATCTCAAATTCCACTGAAGCTGGGCAGAAGTTGCTCAAGATGCTGAGTCTT
GGAAATTCAGAGCCCTGGACCAAAGCCTTGGAAAATGTGGTAGGAGCAAGGAATATGGATGTAAAACCAC
TGCTCAATTACTTCCAACCGTTGTTTGACTGGCTGAAAGAGCAGAACAGAAATTCTTTTGTGGGGTGGAA
CACTGAATGGAGCCCATATGCCGACCAAAGCATTAAAGTGAGGATAAGCCTAAAATCAGCTCTTGGAGCT
AATGCATATGAATGGACCAACAACGAAATGTTCCTGTTCCGATCATCTGTTGCATATGCCATGAGAAAGT
ATTTTTCAATAATCAAAAACCAGACAGTTCCTTTTCTAGAGGAAGATGTACGAGTGAGTGATTTGAAACC
AAGAGTCTCCTTCTACTTCTTTGTCACCTCACCCCAAAATGTGTCTGATGTCATTCCTAGAAGTGAAGTT
GAAGATGCCATCAGGATGTCTCGGGGCCGCATCAATGATGTCTTTGGCCTGAATGATAACAGCCTGGAGT
TTCTGGGGATTCACCCAACACTTGAGCCACCTTACCAGCCTCCTGTCACCATATGGCTGATTATTTTTGG
TGTTGTGATGGCACTGGTAGTGGTTGGCATCATCATCCTGATTGTCACTGGGATCAAAGGTCGAAAGAAG
AAAAATGAAACAAAAAGAGAAGAGAACCCTTATGACTCGATGGACATTGGAAAAGGAGAAAGCAATGCAG
GATTCCAAAACAGTGATGATGCTCAGACTTCCTTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001130513
Insert Size 2418 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130513.1, NP_001123985.1
RefSeq Size 3566 bp
RefSeq ORF 2418 bp
Locus ID 70008
UniProt ID Q8R0I0
Cytogenetics X 76.12 cM
Gene Summary Carboxypeptidase which converts angiotensin I to angiotensin 1-9, a peptide of unknown function, and angiotensin II to angiotensin 1-7, a vasodilator. Also able to hydrolyze apelin-13 and dynorphin-13 with high efficiency. May be an important regulator of heart function. May have a protective role in acute lung injury. Plays an important role in amino acid transport by acting as binding partner of amino acid transporter SLC6A19, regulating its trafficking on the cell surface and its activity (PubMed:19185582).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.