Appl1 (NM_145221) Mouse Untagged Clone

CAT#: MC220835

Appl1 (untagged) - Mouse adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 (Appl1), (10ug)

  View "NM_145221" in other vectors (6)

USD 930.00


Availability*
5 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Appl1 (NM_145221) Mouse Untagged Clone
Symbol Appl1
Synonyms 2900057D21Rik; 7330406P05Rik; AI585782; AW209077; BB022931; C88264; DIP13
Vector pCMV6-Entry
Sequence Data
>MC220835 representing NM_145221
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGGGGATCGACAAGCTGCCCATTGAAGAGACCCTGGAGGACAGTCCGCAGACAAGGTCTTTACTTG
GTGTATTTGAAGAAGATGCTACTGCTATTTCAAATTATATGAACCAATTGTATCAAGCTATGCATCGGAT
TTATGATGCACAGAATGAATTGAGTGCAGCAACACACCTGACTTCGAAACTTTTGAAAGAATATGAAAAA
CAGCGTTTTCCTTTGGGGGGTGATGATGAAGTTATGAGCTCTACTTTGCAGCAGTTTTCCAAGGTCATAG
ATGAGCTTAGTTCTTGTCATGCAGTACTTTCAACTCAACTTGCTGATGCCATGATGTTCCCCATTTCCCA
GTTTAAAGAAAGAGATCTGAAAGAAATATTGACACTAAAGGAGGTATTTCAAATTGCTAGTAATGATCAT
GATGCCGCAATTAATAGGTACAGTCGGTTGTCAAAAAAGAGAGAAAATGACAAGGTAAAATATGAAGTTA
CAGAGGATGTATATACTTCCAGGAAAAAACAACACCAGACCATGATGCATTATTTTTGTGCACTAAATAC
TCTTCAGTACAAGAAGAAAATAGCTTTGTTAGAACCTCTACTGGGATACATGCAGGCTCAGATAAGTTTC
TTTAAGATGGGTTCTGAAAATCTCAATGGACAACTGGAAGAATTCTTAGCTAACATTGGAACAAGTGTAC
AGAATGTTCGAAGAGAAATGGATGGTGATGTAGAGACCATGCAGCAGACAATAGAAGACTTGGAGGTAGC
CAGTGACCCTTTATATCTGCCTGACCCGGATCCCACCAAGTTTCCCATCAATCGAAATTTAACCCGAAAG
GCTGGATACCTAAATGCTAGGAATAAAACAGGCTTGGTGTCATCTACCTGGGATAGACAGTTTTACTTCA
CGCAGGGTGGAAACTTAATGAGTCAAGCCCGTGGAGATGTGGCAGGAGGCCTAGCCATGGACATAGACAA
CTGTTCAGTGATGGCTGTGGACTGTGAAGACAGACGATACTGTTTTCAGATCACTTCTTTTGATGGAAAA
AAATCTTCAATATTGCAAGCAGAGAGTAAAAAAGACCATGAAGAGTGGATCTGTACAATAAACAACATAT
CTAAACAAATATATTTGAGTGAAAATCCAGAGGAAACTGCTGCACGAGTGAATCAGTCTGCTCTAGAAGC
TGTCACTCCTTCCCCATCTTTCCAGCAGAGACACGAGAGCCTGCGTCCAGGAGGACAATCTCGGCCACCA
ACAGCTCGAACCAGCAGTTCAGGATCCTTGGGATCAGAGTCTACAAATTTGGCTGCCCTCTCTCTAGATT
CTCTTGTTGCTCCGGATACACCAATACAGTTTGATATAATTTCTCCTGTGTGTGAAGATCAGCCTGGCCA
GGCAAAAGCCTTTGGTCAAGGAGGCAGGCGTACAAATCCATTTGGAGAATCTGGAGGAAGCACAAAATCA
GAAACAGAAGACTCTATTCTTCATCAGTTATTTATTGTCCGATTCCTTGGTTCTATGGAGGTAAAGTCAG
ATGACCATCCAGATGTTGTCTATGAAACAATGCGCCAGATCTTAGCTGCTCGGGCCATCCACAACATCTT
TCGTATGACAGAATCACATTTATTAGTCACTTGTGACTGCTTGAAGTTAATTGATCCGCAGACCCAAGTT
ACAAGGCTCACATTTCCATTGCCGTGTGTAGTTCTGTATGCTACGCACCAGGAAAATAAACGACTTTTTG
GATTTGTTCTCCGGACATCAGGCGGAAGAAGTGAGAGTAATTTGTCATCAGTCTGCTATATATTTGAATC
AAACAATGAGGGAGAAAAGATTTGTGATTCTGTTGGACTGGCAAAACAGATAGCTTTGCATGCTGAACTG
GATCGTAGGGCATCAGAAAAACAAAAAGAAATAGAGAGAGTAAAAGAGAAACAGCAGAAAGAGCTCAGCA
AACAGAAACAGATTGAGAAGGACTTGGAAGAACAGAGTCGGTTGATAGCTGCCTCCAGTAGACCAAACCA
GGCTGGTAGTGAGGGCCAGCTTGTTCTTAGCAGTAGCCAATCAGAGGAGAGTGATTTGGGAGAAGAAGGG
AAAAAAAGAGAGTCGGAAGCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_145221
ORF Size 2124 bp
Insert Size 2124
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_145221.2, NP_660256
RefSeq Size 6961
RefSeq ORF 2124
Locus ID 72993
Cytogenetics 14|14 A3

Other Versions

Other products for "Appl1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones