Spast (NM_001162870) Mouse Untagged Clone

CAT#: MC219723

Spast (untagged) - Mouse spastin (Spast), transcript variant 1, (10ug)


  "NM_001162870" in other vectors (4)

Reconstitution Protocol

USD 916.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Spast"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Spast
Synonyms mKIAA1083; Spg4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC219723 representing NM_001162870
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTTCTCCGGCCGGACGACGGAAGAAGAAAGGCTCGGGCGGCGCGAGCCCGGCGCCCGCCAGGCCTC
CGCCCCCCGCCGCGGTCCCCGCCCCTGCCGCCGGCCCGGCCCCTGCGGCCGGCTCGCCGCCTAAGCGGAA
CCCGTCTTCTTTCTCGTCCCCGCTGGTCGTCGGCTTCGCCCTGCTGCGCCTGCTGGCCTGCCACCTGGGG
CTCCTCTTCGCGTGGCTCTGCCAGCGCTTCTCCCGCGCCCTCATGGCCGCCAAGAGGAGCTCCGGGACCG
CGCCGGCGCCCGCCTCGCCCTCGCCCCCAGAGCCCGGACCGGGTGGCGAGGCCGAGAGCGTCCGCGTCTT
CCACAAGCAGGCCTTCGAGTACATCTCCATTGCCCTGCGCATCGACGAGGAAGAGAAAGCAGGACAGAAG
GAACAAGCTGTGGAATGGTATAAGAAAGGTATCGAAGAACTGGAAAAAGGAATCGCTGTTATAGTTACGG
GCCAAGGTGAACAGTATGAAAGAGCTAGACGTCTTCAAGCCAAAATGATGACTAATTTAGTTATGGCCAA
GGACCGTTTACAACTTCTAGAGAAGCTGCAACCAGTTTTGCAATTTTCCAAGTCACAGACGGACGTCTAT
AACGAGAGTACTAACCTGACATGCCGCAATGGACATCTCCAGTCAGAAAGTGGAGCAGTTCCGAAGAGGA
AAGACCCCTTAACACATGCTAGTAATTCATTGCCTCGATCAAAAACTGTCCTGAAAAGTGGCTCCGCAGG
GCTCTCCGGTCACCACAGGGCGCCTAGTTGCAGTGGTTTGTCCATGGTTTCTGGAGCAAGACCGGGACCT
GGTCCTGCAGCTACCACACATAAGGGTACTCCAAAACCAAATAGAACCAACAAACCTTCTACTCCCACAA
CTGCAGTTCGGAAAAAGAAAGACTTGAAAAATTTTAGGAATGTGGACAGCAATCTTGCTAACCTTATAAT
GAATGAAATTGTTGACAATGGGACAGCTGTTAAGTTTGATGACATAGCCGGGCAGGAGCTGGCAAAGCAA
GCGCTGCAGGAGATTGTCATCCTTCCTTCTCTGCGGCCTGAGTTGTTCACAGGGCTCAGAGCTCCTGCTA
GAGGCTTGTTACTCTTCGGTCCGCCAGGAAACGGAAAAACAATGCTGGCTAAAGCAGTAGCTGCAGAGTC
TAATGCGACCTTTTTCAACATAAGTGCTGCCAGTTTAACTTCAAAATATGTGGGAGAAGGAGAGAAATTG
GTGAGAGCTCTCTTTGCTGTGGCTCGAGAACTTCAACCATCTATAATTTTTATAGATGAAGTTGACAGTC
TTTTGTGTGAGAGACGGGAAGGGGAGCACGACGCTAGCAGACGGCTAAAGACGGAATTTTTAATAGAATT
TGACGGGGTGCAATCTGCTGGAGATGACAGAGTACTTGTAATGGGTGCAACTAACAGGCCCCAAGAGCTT
GATGAAGCTGTTCTCAGGCGTTTCATTAAACGGGTATATGTGTCCTTACCAAATGAGGAGACAAGACTCC
TTCTGCTTAAAAACCTGTTGTGTAAACAAGGAAGTCCACTGACCCAAAAAGAACTCGCACAGCTTGCTAG
AATGACCGATGGATACTCTGGAAGTGATCTGACCGCTTTGGCCAAGGATGCAGCCCTGGGTCCTATCCGA
GAACTGAAGCCAGAGCAGGTGAAGAATATGTCTGCCAGTGAGATGAGAAATATTCGATTATCTGACTTCA
CAGAATCCTTAAAAAAGATAAAACGCAGTGTGAGTCCTCAGACCTTAGAAGCATACATACGCTGGAACAA
GGATTTTGGAGACACCACTGTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001162870
Insert Size 1845 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001162870.1, NP_001156342.1
RefSeq Size 4696 bp
RefSeq ORF 1845 bp
Locus ID 50850
UniProt ID Q9QYY8
Cytogenetics 17 E2
Gene Summary ATP-dependent microtubule severing protein that specifically recognizes and cuts microtubules that are polyglutamylated (PubMed:19141076 PubMed:20530212). Preferentially recognizes and acts on microtubules decorated with short polyglutamate tails: severing activity increases as the number of glutamates per tubulin rises from one to eight, but decreases beyond this glutamylation threshold (By similarity). Severing activity is not dependent on tubulin acetylation or detyrosination (By similarity). Microtubule severing promotes reorganization of cellular microtubule arrays and the release of microtubules from the centrosome following nucleation (By similarity). It is critical for the biogenesis and maintenance of complex microtubule arrays in axons, spindles and cilia (By similarity). SPAST is involved in abscission step of cytokinesis and nuclear envelope reassembly during anaphase in cooperation with the ESCRT-III complex (By similarity). Recruited at the midbody, probably by IST1, and participates in membrane fission during abscission together with the ESCRT-III complex (By similarity). Recruited to the nuclear membrane by IST1 and mediates microtubule severing, promoting nuclear envelope sealing and mitotic spindle disassembly during late anaphase (By similarity). Required for membrane traffic from the endoplasmic reticulum (ER) to the Golgi and endosome recycling (By similarity). Recruited by IST1 to endosomes and regulates early endosomal tubulation and recycling by mediating microtubule severing (By similarity). Probably plays a role in axon growth and the formation of axonal branches (PubMed:18234839).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.