Tyms (BC020139) Mouse Untagged Clone

SKU
MC218262
Tyms (untagged) - Mouse thymidylate synthase (cDNA clone MGC:28246 IMAGE:3994204), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tyms
Synonyms TS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC020139
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGGTGGTTGGCTCCGAGCTGCAGTCCGATGCTCAGCAGCTGAGCGCGGAAGCCCCGCAGCATGGAG
AACTCCAGTACCTGAGGCAGGTGGAACACATTTTGCGCTGCGGCTTCAAGAAGGAGGACCGCACGGGCAC
AGGCACCCTGTCGGTGTTCGGCATGCAGGCACGATACAGCCTGAGAGATGAATTTCCTCTGCTCACAACC
AAACGAGTGTTCTGGAAGGGTGTTTTGGAGGAGTTGTTGTGGTTTATCAAGGGATCCACAAATGCTAAAG
AATTGTCCTCCAAGGGAGTGAGAATCTGGGATGCCAATGGATCCCGAGATTTTCTGGACAGCTTGGGATT
TTCTGCCCGACAGGAAGGGGACCTGGGCCCAGTTTATGGTTTCCAATGGAGGCATTTTGGAGCAGAGTAC
AAAGATATGGATTCAGATTACTCGGGACAAGGAGTAGACCAGCTGCAAAAAGTGATTGACACCATCAAAA
CCAACCCTGATGACAGAAGAATCATCATGTGTGCCTGGAACCCAAAAGATCTTCCCCTGATGGCACTGCC
TCCTTGCCATGCCCTCTGTCAGTTCTATGTGGTGAATGGGGAACTGTCTTGCCAGCTTTACCAGAGGTCA
GGAGATATGGGTCTGGGCGTGCCCTTCAACATTGCCAGCTATGCTCTGCTCACCTACATGATTGCACATA
TCACAGGCCTGCAGCCAGGTGATTTTGTCCACACTTTGGGAGATGCACATATTTACCTGAATCATATAGA
GCCGCTGAAAATTCAGCTACAGCGAGAACCAAGACCTTTCCCAAAGCTCAAAATCCTTCGAAAAGTTGAG
ACAATCGATGATTTCAAAGTTGAAGACTTTCAGATTGAAGGGTATAATCCACATCCAACGATTAAAATGG
AAATGGCTGTTT


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC020139
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC020139, AAH20139
RefSeq Size 986 bp
RefSeq ORF 923 bp
Locus ID 22171
Cytogenetics 5 15.81 cM
Summary This gene encodes an enzyme that catalyzes the methylation of deoxyuridylate to deoxythymidylate using 5,10-methylenetetrahydrofolate as a cofactor. This function maintains the thymidine-5-prime monophosphate concentration critical for DNA replication and repair. The encoded enzyme is a target for cancer chemotherapeutic agents. The majority of transcripts for this gene lack a 3' UTR (PMID: 3022294, 3444407). The stop codon in these transcripts is UAA, compared to the UAG found in the genome and longer transcripts, as the polyA site is located within the stop codon (PMID: 3444407, 2157203). A related pseudogene has been identified on chromosome 10. [provided by RefSeq, Mar 2010]
Write Your Own Review
You're reviewing:Tyms (BC020139) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204343 Tyms (tGFP-tagged) - Mouse thymidylate synthase (cDNA clone MGC:28246 IMAGE:3994204) 10 ug
$500.00
MR204343 Tyms (Myc-DDK-tagged) - Mouse thymidylate synthase (cDNA clone MGC:28246 IMAGE:3994204) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204343L3 Lenti ORF clone of Tyms (Myc-DDK-tagged) - Mouse thymidylate synthase (cDNA clone MGC:28246 IMAGE:3994204) 10 ug
$600.00
MR204343L4 Lenti ORF clone of Tyms (mGFP-tagged) - Mouse thymidylate synthase (cDNA clone MGC:28246 IMAGE:3994204) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.