Runx2 (NM_001146038) Mouse Untagged Clone

CAT#: MC217412

Reviews ()
Write a review

Runx2 (untagged) - Mouse runt related transcription factor 2 (Runx2), transcript variant 1, (10ug)

  View "NM_001146038" in other vectors (6)

USD 690.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Runx2 (NM_001146038) Mouse Untagged Clone
Symbol Runx2
Synonyms AML3; Cbf; Cbfa-1; Cbfa1; LS3; Osf2; Pebp2a1; PEBP2aA; Pebpa2a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC217412 representing NM_001146038
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCAAACAGCCTCTTCAGCGCAGTGACACCGTGTCAGCAAAGCTTCTTTTGGGATCCGAGCACCA
GCCGGCGCTTCAGCCCCCCCTCCAGCAGCCTGCAGCCCGGCAAGATGAGCGACGTGAGCCCGGTGGTGGC
TGCGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAGCAGCAGCAACAACAGCAACAGCAACAACAG
CAGCAGCAGCAGCAGCAGCAGGAGGCGGCCGCAGCAGCAGCGGCGGCAGCGGCGGCGGCAGCAGCGGCGG
CGGCCGCAGTGCCCCGATTGAGGCCGCCGCACGACAACCGCACCATGGTGGAGATCATCGCGGACCACCC
GGCCGAACTGGTCCGCACCGACAGTCCCAACTTCCTGTGCTCCGTGCTGCCCTCGCACTGGCGGTGCAAC
AAGACCCTGCCCGTGGCCTTCAAGGTTGTAGCCCTCGGAGAGGTACCAGATGGGACTGTGGTTACCGTCA
TGGCCGGGAATGATGAGAACTACTCCGCCGAGCTCCGAAATGCCTCCGCTGTTATGAAAAACCAAGTAGC
CAGGTTCAACGATCTGAGATTTGTGGGCCGGAGCGGACGAGGCAAGAGTTTCACCTTGACCATAACAGTC
TTCACAAATCCTCCCCAAGTGGCCACTTACCACAGAGCTATTAAAGTGACAGTGGACGGTCCCCGGGAAC
CAAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGATCGCCTCAGTGATTTAGG
GCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCA
CCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGATCCCAGGCAGGCACAGTCTTCCCCACCGT
GGTCCTATGACCAGTCTTACCCCTCCTATCTGAGCCAGATGACATCCCCATCCATCCACTCCACCACGCC
GCTGTCTTCCACACGGGGCACCGGGCTACCTGCCATCACTGACGTGCCCAGGCGTATTTCAGATGATGAC
ACTGCCACCTCTGACTTCTGCCTCTGGCCTTCCTCTCTCAGTAAGAAGAGCCAGGCAGGTGCTTCAGAAC
TGGGCCCTTTTTCAGACCCCAGGCAGTTCCCAAGCATTTCATCCCTCACTGAGAGCCGCTTCTCCAACCC
ACGAATGCACTACCCAGCCACCTTTACCTACACCCCGCCAGTCACGTCAGGCATGTCCCTCGGCATGTCC
GCCACCACTCACTACCACACGTACCTGCCACCACCCTACCCCGGCTCTTCCCAAAGCCAGAGTGGACCCT
TCCAGACCAGCAGCACTCCATATCTCTACTATGGTACTTCGTCAGCATCCTATCAGTTCCCAATGGTACC
CGGGGGAGACCGGTCTCCTTCCAGGATGGTCCCACCATGCACCACCACCTCGAATGGCAGCACGCTATTA
AATCCAAATTTGCCTAACCAGAATGATGGTGTTGACGCTGACGGAAGCCACAGCAGTTCCCCAACTGTTT
TGAATTCTAGCGGCAGAATGGATGAGTCTGTTTGGCGGCCATATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001146038
ORF Size 1587 bp
Insert Size 1587
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001146038.2, NP_001139510
RefSeq Size 5740
RefSeq ORF 1587
Locus ID 12393
Cytogenetics 17 21.33 cM
Gene Summary This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents use of a distal promoter. It encodes the longest isoform (1, also called MASNS).

Other Versions

Other products for "Runx2"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones