Erg (NM_133659) Mouse Untagged Clone

CAT#: MC216626

Erg (untagged) - Mouse avian erythroblastosis virus E-26 (v-ets) oncogene related (Erg), (10ug)

USD 618.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Erg (NM_133659) Mouse Untagged Clone
Symbol Erg
Synonyms D030036I24Rik
Vector pCMV6-Entry
Sequence Data
>MC216626 representing NM_133659
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCAGACTGTACCTGACCCAGCAGCTCATATTAAGGAGGCCTTGTCAGTTGTGAGCGAGGACCAGT
CACTATTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCATCCTCTTCCAGTGA
CTATGGCCAGACATCCAAGATGAGTCCCAGAGTCCCTCAGCAGGACTGGCTGTCTCAAGCCCCAGCCAGG
GTCACCATCAAGATGGAGTGCAACCCTAGTCAGGTGAATGGTTCCAGGAACTCACCTGATGAGTGCAGTG
TGAACAAAGGTGGGAAGATGGTGGGCAGCCCGGATACTGTGGGGATGAGCTACGGCAGCTACATGGAGGA
GAAGCATGTGCCGCCTCCCAATATGACCACAAATGAGCGCAGAGTGATCGTCCCTGCAGATCCTACTCTG
TGGAGCACAGACCATGTCCGACAGTGGCTGGAGTGGGCGGTGAAAGAATATGGCCTCCTCGATGTGGACG
TCTTACTATTTCAGAATATCGATGGGAAGGAGCTGTGCAAGATGACAAAGGATGACTTCCAGCGGCTCAC
GCCGAGCTACAATGCCGACATTCTTCTCTCACATCTCCACTACCTCAGAGAGACTCCCCTTCCACATCTG
ACTTCCGATGACGTTGATAAGGCTTTACAAAACTCTCCACGGTTAATGCATGCCAGAAACACAGGGGGTG
CAGCTTTTATTTTCCCAAATACTTCAGTATATCCCGAAGCTACGCAAAGAATTACAACTAGGCCAGATTT
ACCTTATGAGCCTCCCAGGAGATCAGCCTGGACCGGCCACAGCCACCTCACCCCTCAGTCCAAAGCTGCT
CAGCCATCTCCCTCTGCAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTACCAGATCCTGG
GACCGACCAGTAGCCGCCTTGCTAATCCAGGTAGTGGCCAGATCCAGCTGTGGCAGTTCCTGCTCGAACT
CCTGTCAGACAGCTCCAACTCCAACTGCATCACCTGGGAAGGCACCAACGGGGAGTTCAAGATGACAGAC
CCGGACGAGGTGGCTCGGCGCTGGGGGGAGAGGAAGAGCAAGCCCAACATGAACTATGACAAGCTCAGCC
GCGCCCTCCGCTACTACTACGACAAAAACATCATGACCAAGGTGCACGGGAAGCGCTACGCCTACAAGTT
TGACTTCCACGGGATTGCCCAGGCCCTGCAGCCCCACCCTCCTGAGTCGTCCCTGTACAAGTACCCCTCC
GACCTGCCATACATGGGCTCCTATCACGCCCACCCCCAGAAGATGAACTTTGTGTCTCCCCACCCTCCCG
CTCTCCCAGTCACATCTTCCAGTTTCTTTGCTTCCCCGAACCCATACTGGAATTCACCGACTGGGGGCAT
CTACCCGAACACTAGGCTCCCAGCCAGCCATATGCCCTCTCACCTGGGCACCTACTACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_133659
ORF Size 1461 bp
Insert Size 1461
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_133659.3, NP_598420
RefSeq Size 3259
RefSeq ORF 1461
Locus ID 13876
Cytogenetics 16 C4|16 56.04 cM
Gene Summary Transcriptional regulator. May participate in transcriptional regulation through the recruitment of SETDB1 histone methyltransferase and subsequent modification of local chromatin structure. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.