Gm10767 (NM_001177750) Mouse Untagged Clone

CAT#: MC215465

Gm10767 (untagged) - Mouse predicted gene 10767 (Gm10767), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gm10767 (NM_001177750) Mouse Untagged Clone
Symbol Gm10767
Synonyms ENSMUSG00000074826
Vector pCMV6-Entry
Sequence Data
>MC215465 representing NM_001177750
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGATACTTCTGAAGTAATTCCAAATTTTGAAGACATGTTTGCAAGCAGATTCACGAAAGATGGCA
AAGAATACCAGGAATACTTGAAACGCCCTCCTGAGTCCCCTCCAATTGTTGAGGAATGGAATAGCAGAGC
TGGTGGTAACCAAAGAAATAGAGGCAACTGGCTGCAAGACAACAGACAATTTAGAGGTAGGGATAACAGA
CAAGGATGGCCAACTGACAACCGGTCAAATCAGTGGCATGGATGGACATGGGGTAACAACAACTACCCAC
AGCAGAGACCAGAGCCCTACTATCAACAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001177750
ORF Size 312 bp
Insert Size 312
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001177750.1, NP_001171221
RefSeq Size 1652
RefSeq ORF 312
Locus ID 100038538
Cytogenetics 13 B3|13
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.