C330019L16Rik (NM_001034857) Mouse Untagged Clone

CAT#: MC212495

C330019L16Rik (untagged) - Mouse RIKEN cDNA C330019L16 gene (C330019L16Rik), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name C330019L16Rik (NM_001034857) Mouse Untagged Clone
Symbol C330019L16Rik
Vector pCMV6-Entry
Sequence Data
>MC212495 representing NM_001034857
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAGAACACATACTGGAGAGAAACCTTATATATGTAATCTGTGTGATAAAGCCTATTCACACCAGAA
ATATCTCCAAATACATGAAAAAACACATACTGGTGAGAAACCCTATAAATGTAATCAGTGTGATAAAGGC
TTTGCACAGCTCAGGTACCTTCGAGCACATGAAAGAACACATACTCAAGAGAAAACCTACAAATGTAATC
AATGTGGTAAAGCCTTTGCACAGCTCACCTATCTTCGAGTACATGAAAGAAGACATAGTGGAGAGAAACC
CTACAAATGTAATGAATGTGATAAAGCCTTTTTACAGCTCAAGTATCTTCGATTACATGAAAGAAGACAT
AGTGGAGAGAAACCCTATGAATGTAATCAATGTGGTAAAGCCTTTTTACATCCCAGCTATCTTCGAATGC
ATGAAAGAACACATACTGGAGAGAAACCTTACCAATGTAATGAATGTGATAAAGCCTTCTTACATCCCAG
CTATCTTAGAATGCATGAAAGAAGACATAGTGGAGAGAAACCCTATGAATGTAATCAATGTGGTAAAGCC
TTTTTGCAATCCCACTATCTTCGAATGCATGAAAGAACACATACTGGAGAGAAACCCTATGAATGTAATC
AATGTGGTAAAGCCTTTTTACATCTCAGCTATCTTCGAATGCATGAAAGAAGACATAGTGGAGAGAAACC
CTATGAATGTAATCAATGTGGTAAAGCGTTTTTATATCCCAGCTATCTTCGAATGCATGAAAGAACACAT
AGTGGAGAGAAACCCTATGAATGTAATCAATGTGGTAAAGCCTTTTTACATTCCAGCTATCTTCAAATGC
ATGAAAGAACACATAGTGGAGAGAAACCCTATGAATGTAATCAATGTGGTAAAGCCTTTTCACATTCCAG
CTATCTTCAAATGCATGAAAGAACACATACTGGAGAGAAACCCTATGAATGTAATCAATGTGGTAAAGCC
TTTTTGCAACCCCACTATCTTCGAAAACATGAAAAAACACATACTAGAGAGAAACCTTACAAATGAGATC
AATGTGGTAAGGCCCTTACACAAAGCAGTCATCTTAAAACCCATAAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001034857
ORF Size 1101 bp
Insert Size 1101
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001034857.3, NP_001030029
RefSeq Size 4868
RefSeq ORF 1101
Locus ID 208111
Cytogenetics 7|7 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

"C330019L16Rik" in other Product Lines