Cdc42se2 (NM_178626) Mouse Untagged Clone

CAT#: MC211354

Cdc42se2 (untagged) - Mouse CDC42 small effector 2 (Cdc42se2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cdc42se2
• Synonyms: 2810404F18Rik; AA408783; AA536669; SPEC2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211354 representing NM_178626
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTGAATTCTGGTTGTGTTTCAACTGCTGTATTGCAGAGCAGCCTCAGCCTAAGAGGCGACGACGGA
  TTGACCGAAGTATGATCGGAGAGCCAACCAACTTTGTGCACACAGCTCACGTAGGATCCGGAGACCTATT
  TAGTGGGATGAACTCAGTCAGCTCCATTCAGAACCAGATGCAGTCCAAGGGAGGCTATGGAGGTGGAATG
  CCTGCCAACGTGCAGATGCAGCTCGTGGACACCAAGGCAGGATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_178626
• Insert Size: 255 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_178626.3, NP_848741.1
• RefSeq Size: 3138 bp
• RefSeq ORF: 255 bp
• Locus ID: 72729
• UniProt ID: Q8BGH7
• Cytogenetics: 11 B1.3
• Gene Summary: Probably involved in the organization of the actin cytoskeleton by acting downstream of CDC42, inducing actin filament assembly. Alters CDC42-induced cell shape changes. In activated T-cells, may play a role in CDC42-mediated F-actin accumulation at the immunological synapse. May play a role in early contractile events in phagocytosis in macrophages (By similarity).[UniProtKB/Swiss-Prot Function]