Shisa9 (NM_028277) Mouse Untagged Clone

CAT#: MC211341

Shisa9 (untagged) - Mouse shisa homolog 9 (Xenopus laevis) (Shisa9), transcript variant 1, (10ug)

USD 402.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Shisa9 (NM_028277) Mouse Untagged Clone
Symbol Shisa9
Synonyms 2700045P11Rik; Ckamp44
Vector pCMV6-Entry
Sequence Data
>MC211341 representing NM_028277
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGCCGAGTCCTTCGGCTGCTTCTCGGCTGCTTCCTCACCGAGCTGTGTGCCCGCATGTGCCGGGCGC
AGGAGCGATCTGGGCACGGGCAGCTAGCGCAACTGGGCGGCGTACTGCTGCTCACAGGGGGCAACCGCTC
CGGAGCCGCCTCCGGAGAGGCCGGCGAGGGCGTCGGGGGCTCGGACGCACCGCCGACTCGAGCGCCCACG
CCAGACTCCTGTCGGGGCTACTTCGATGTCATGGGCCAGTGGGACCCGCCGTTCAACTGCAGCTCGGGCG
ACTTCATCTTCTGCTGCGGGACTTGTGGCTTCCGGTTCTGCTGCACGTTTAAGAAGCGGCGACTGAACCA
GAGCACCTGTACCAACTACGACACGCCACTCTGGCTTAACACGGGCAAGCCCCCAGCGCGTAAGGATGAC
CCCTTGCACGACCCCACCAAGGACAAGACCAACCTTATCGTCTACATCATCTGCGGGGTGGTGGCTGTCA
TGGTGCTGGTGGGCATCTTCACCAAGCTGGGGCTGGAGAAAGCGCACCGGCCCCAAAGGGAACACATGTC
CAGAGCCCTTGCGGATGTCATGAGGCCACAGGGCCACTGCAACACTGACCACATGGAGAGAGACCTTAAC
ATCGTGGTCCACGTGCAGCATTATGAGAACATGGACTCAAGAACCCCCATAAATAATCTCCATACCACTC
AGATGAACAACGCAGTGCCCACTTCTCCTCTGCTCCAGCAGATGGGACACCCACATTCATACCCCAACCT
GGGTCAGATTTCTAATCCATATGAACAGCAGCCTCCAGGCAAAGAGCTCAACAAGTACGCCTCCTTAAAG
GCAGTAGGAAATTCTGATGGTGACTGGGCAGTGGCAACGCTTAAGTCACCAAAAGCTGACAAGGTCAATG
ATGACTTCTACGCCAAAAGAAGGCACCTGGCAGAGCTGGCTGTCAAGGGAAATCTCCCTTTGCACCCTGT
AAGAGTGGAAGATGAGCCTCGCGCCTTCAGCCCAGAGCACGGGCCTGCACAGCAGAATGGACAGAAGTCT
CGCACCAACAAGATGCCCCCACATCCCCTGGCCTACAACTCTACTGCCAACTTTAAGACCTGGGACCCCA
GTGACCAGTCTCTCCGGCGGCAGGCTTATGGCAACAAGGGCAAGCTTGGCATAGCTGAGTCAGGCTCTTG
TGACCCCTTGGGGACTCGCACCCAGCACTTCCCACCCACACAGCCATATTTCATCACTAACAGCAAAACA
GAAGTGACTGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_028277
ORF Size 1275 bp
Insert Size 1275
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_028277.2, NP_082553
RefSeq Size 4844
RefSeq ORF 1275
Locus ID 72555
Cytogenetics 16 A1|16
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.