Cartpt (NM_001081493) Mouse Untagged Clone
CAT#: MC209778
Cartpt (untagged) - Mouse CART prepropeptide (Cartpt), transcript variant 2, (10ug)
"NM_001081493" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cartpt |
Synonyms | Ca; Cart |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209778 representing NM_001081493
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGAGCTCCCGCCTGCGGCTGCTACCCCTCCTGGGCGCCGCCCTGCTGCTACTGCTACCTTTGCTGG GTGCCCGTGCCCAGGAGGACGCCGAGCTGCAGCCCCGAGCCCTGGACATCTACTCTGCCGTGGATGATGC GTCCCACGAGAAGGAGCTGATCGAAGCGTTGCAAGAAGTCCTGAAGAAGCTCAAGAGTAAACGCATTCCG ATCTACGAGAAGAAGTACGGCCAAGTCCCCATGTGTGACGCTGGAGAGCAGTGCGCAGTGAGGAAAGGGG CCAGGATCGGGAAGCTGTGTGACTGTCCCCGAGGAACTTCCTGCAATTCTTTCCTCTTGAAGTGCTTGTG A ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001081493 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001081493.2, NP_001074962.1 |
RefSeq Size | 836 bp |
RefSeq ORF | 351 bp |
Locus ID | 27220 |
Cytogenetics | 13 D1 |
Gene Summary | This gene encodes preproprotein isoforms that are processed into multiple biologically active peptides. Expression of this gene is regulated by cocaine and other drugs, and is associated with feeding/appetite and stress response. Mice lacking the encoded protein are predisposed to obesity. Deficiency of the encoded protein in mice results in pancreatic islet dysfunction, impaired insulin secretion and glucose intolerance. Alternative splicing results in multiple transcript variants encoding different isoforms, which are subsequently processed into mature peptides. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221975 | Cartpt (tGFP-tagged) - Mouse CART prepropeptide (Cartpt) transcript variant 2, (10ug) |
USD 365.00 |
|
MR221975 | Cartpt (Myc-DDK-tagged) - Mouse CART prepropeptide (Cartpt), transcript variant 2 |
USD 165.00 |
|
MR221975L3 | Lenti ORF clone of Cartpt (Myc-DDK-tagged) - Mouse CART prepropeptide (Cartpt), transcript variant 2 |
USD 465.00 |
|
MR221975L4 | Lenti ORF clone of Cartpt (mGFP-tagged) - Mouse CART prepropeptide (Cartpt), transcript variant 2 |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review