Vbp1 (NM_011692) Mouse Untagged Clone

SKU
MC209631
Vbp1 (untagged) - Mouse von Hippel-Lindau binding protein 1 (Vbp1), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Vbp1
Synonyms VBP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209631 representing NM_011692
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGCTAAGGACGGATGCGGCCTAGAAACTGCTGCTGGAAACGGGCGGCGGCTCCACTTAGGGA
TTCCTGAAGCAGTGTTTGTGGAAGATGTAGATTCTTTCATGAAGCAGCCTGGGAATGAGACTGCAGATAC
AGTGTTAAAGAAGCTGGATGAACAATACCAGAAGTATAAGTTTATGGAACTCAACCTTGCTCAGAAAAAA
AGGAGGCTGAAAGGTCAGATTCCTGAAATTAAACAGACTTTGGAAATTCTGAAATACATGCAGAAGAAAA
AAGAGTCTACCAATTCAATGGAGACGAGATTCTTACTGGCCGATAACCTGTACTGCAAAGCTTCAGTCCC
TCCTACTGATAAAGTATGCCTATGGTTGGGGGCTAATGTAATGCTTGAATATGATATTGATGAAGCTCAG
GCCTTGTTGGAAAAGAATTTATCAACTGCCACAAAGAATCTTGATTCTCTTGAAGAAGACCTTGACTTTC
TTCGAGATCAGTTTACTACCACAGAAGTCAATATGGCCAGGGTTTATAATTGGGATGTAAAACGAAGAAA
CAAAGATGATTCTACCAAGAATAAAGCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_011692
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011692.2, NP_035822.2
RefSeq Size 1601 bp
RefSeq ORF 591 bp
Locus ID 22327
UniProt ID P61759
Cytogenetics X 38.25 cM
Summary Binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. Binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Vbp1 (NM_011692) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG226830 Vbp1 (tGFP-tagged) - Mouse von Hippel-Lindau binding protein 1 (Vbp1), (10ug) 10 ug
$500.00
MR226830 Vbp1 (Myc-DDK-tagged) - Mouse von Hippel-Lindau binding protein 1 (Vbp1) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR226830L3 Lenti ORF clone of Vbp1 (Myc-DDK-tagged) - Mouse von Hippel-Lindau binding protein 1 (Vbp1) 10 ug
$600.00
MR226830L4 Lenti ORF clone of Vbp1 (mGFP-tagged) - Mouse von Hippel-Lindau binding protein 1 (Vbp1) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.