Pitx2 (NM_001042504) Mouse Untagged Clone

CAT#: MC209171

Pitx2 (untagged) - Mouse paired-like homeodomain transcription factor 2 (Pitx2), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pitx2
• Synonyms: 9430085M16Rik; Brx1; Brx1b; Munc30; Otlx2; Ptx2; Rieg
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209171 representing NM_001042504
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGACCAATTGTCGCAAACTAGTGTCGGCCTGCGTGCAATTAGAGAAAGATAAGGGCCAGCAAGGAA
  AGAATGAGGATGTGGGCGCCGAGGACCCGTCCAAGAAGAAGCGGCAACGCCGGCAGAGGACTCATTTCAC
  TAGCCAGCAGCTGCAGGAGCTGGAAGCCACTTTCCAGAGAAACCGCTACCCAGACATGTCCACTCGCGAA
  GAAATCGCCGTGTGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGCCGGGCCAAAT
  GGAGAAAGCGGGAACGCAACCAGCAGGCCGAGCTGTGCAAGAATGGCTTTGGGCCGCAGTTCAACGGGCT
  CATGCAGCCCTACGATGACATGTACCCCGGCTATTCGTACAACAATTGGGCTGCCAAGGGCCTCACGTCA
  GCGTCTCTGTCCACCAAGAGCTTCCCCTTCTTCAACTCCATGAACGTCAATCCCCTGTCCTCTCAGAGTA
  TGTTTTCCCCGCCCAACTCCATCTCATCTATGAGTATGTCGTCCAGCATGGTGCCCTCCGCGGTGACCGG
  CGTCCCGGGCTCCAGCCTCAATAGCCTGAATAACTTGAACAACCTGAGCAGCCCGTCGCTGAATTCCGCG
  GTGCCCACGCCCGCCTGTCCTTACGCGCCGCCGACTCCTCCGTACGTTTATAGGGACACATGTAACTCGA
  GCCTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTGCAGAACCCGGC
  CTCCAACCTGAGTGCTTGCCAGTATGCAGTCGACCGGCCGGTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001042504
• Insert Size: 816 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001042504.2, NP_001035969.1
• RefSeq Size: 1808 bp
• RefSeq ORF: 816 bp
• Locus ID: 18741
• UniProt ID: P97474
• Cytogenetics: 3 57.84 cM
• Gene Summary: Controls cell proliferation in a tissue-specific manner and is involved in morphogenesis. During embryonic development, exerts a role in the expansion of muscle progenitors. May play a role in the proper localization of asymmetric organs such as the heart and stomach. Isoform Ptx2c is involved in left-right asymmetry the developing embryo.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the shortest transcript and encodes the shortest isoform (a, also known as PITX2A). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.