Htr1d (NM_008309) Mouse Untagged Clone

CAT#: MC208725

Htr1d (untagged) - Mouse 5-hydroxytryptamine (serotonin) receptor 1D (Htr1d), (10ug)


  "NM_008309" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Htr1d"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Htr1d
Synonyms 5-HT-1D; 5-HT1D; AI853647; Gpcr14; Htr1db
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208725 representing NM_008309
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCCTCCAAACCAGTCCCTAGAAGGCCTTCCTCAGGAGGCCTCCAACAGATCCCTGAATGTGACAG
GGGCTTGGGACCCAGAGGTCCTGCAGGCTCTCAGAATCTCGCTCGTGGTGGTGCTGTCCGTCATCACACT
GGCCACTGTCCTCTCCAATGCCTTCGTCCTTACCACCATTCTACTCACCAAGAAGCTCCACACCCCAGCC
AATTATCTCATTGGCTCCTTGGCCACCACGGACCTCCTGGTTTCTATCTTGGTCATGCCCATCAGCATAG
CCTACACCACCACCCGCACCTGGAACTTTGGCCAGATCCTGTGTGACATCTGGGTGTCTTCTGACATCAC
GTGCTGCACGGCCTCCATCTTGCATCTCTGTGTCATTGCTCTGGACAGATACTGGGCCATCACCGATGCC
CTGGAGTACAGCAAGCGTCGAACCGCAGGCCACGCAGCAGCCATGATTGCGGCCGTCTGGATCATCTCTA
TTTGTATCTCCATCCCTCCACTCTTCTGGCGGCAGGCCACGGCTCACGAGGAGATGTCCGACTGCCTGGT
GAACACATCTCAGATTTCTTACACCATCTACTCGACCTGTGGCGCCTTCTATATCCCATCCATCTTGCTC
ATTATCCTGTATGGCCGCATATACGTGGCCGCCCGGAGTCGAATCCTGAACCCACCCTCCCTCTACGGGA
AGCGCTTCACCACGGCACAGCTTATCACAGGCTCTGCTGGCTCTTCGCTCTGCTCGCTCAACCCCAGCCT
CCATGAGAGCCACACACACACAGTTGGCTCCCCTCTCTTTTTCAACCAGGTGAAAATCAAGCTTGCTGAT
AGCATCCTAGAACGCAAGAGGATCTCTGCAGCCCGAGAAAGGAAAGCCACTAAGACCCTGGGCATCATTC
TGGGGGCCTTTATCATCTGCTGGTTGCCTTTCTTTGTAGTATCATTGGTCCTCCCCATCTGCAGGGACTC
TTGTTGGATCCACCCGGCCCTCTTTGACTTCTTCACGTGGCTAGGTTATTTAAACTCTCTCATTAACCCC
GTCATCTACACTGTGTTCAACGAAGACTTTCGACAAGCGTTTCAGAAAGTCGTCCATTTCCGGAAGATCT
CATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008309
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_008309.5, NP_032335.2
RefSeq Size 2921 bp
RefSeq ORF 1125 bp
Locus ID 15552
UniProt ID Q61224
Cytogenetics 4 68.74 cM
Gene Summary G-protein coupled receptor for 5-hydroxytryptamine (serotonin). Also functions as a receptor for various alkaloids and psychoactive substances. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of down-stream effectors, such as adenylate cyclase. Signaling inhibits adenylate cyclase activity. Regulates the release of 5-hydroxytryptamine in the brain, and thereby affects neural activity. May also play a role in regulating the release of other neurotransmitters. May play a role in vasoconstriction.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 all encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.