Gsc (NM_010351) Mouse Untagged Clone

CAT#: MC208601

Gsc (untagged) - Mouse goosecoid homeobox (Gsc), (10ug)


  "NM_010351" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
GSC Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gsc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NM_010351.1
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCGCCAGCATGTTCAGCATCGACAACATCCTGGCCGCCCGGCCGCGCTGCAAAGACGCGGTGCTCC
CGGTGGCGCCCAGCGCCGCGGCTCCGGTGGTCTTCCCGGCTCTACACGGGGACTCGCTCTACGGCGCCGG
CGGCGGCACCTCCTCGGACTACGGCGCCTTCTACCCGCGCCCTGTGGCCCCCGGAGGCGCGGGCCTCCCG
GCCGCGGTCGGCAGCTCCCGCCTGGGCTACAACAGCTACTTCTACGGGCAGCTGCACGTGCAGGCGGCGC
CCGTGGGCCCGGCTTGCTGCGGGGCTGTGCCGCCGCTGGGCGCCCAGCAGTGCTCCTGCGTCCCGACGCC
CCCAGGCTACGAGGGCCCCGGTTCTGTACTGGTGTCTCCGGTGCCGCACCAGATGCTGCCCTACATGAAC
GTGGGCACGCTGTCGCGCACTGAGCTGCAGCTGCTCAACCAGCTGCACTGTCGGCGGAAGCGGCGGCACC
GCACCATCTTCACCGATGAGCAGCTCGAAGCCCTGGAGAACCTCTTCCAGGAGACGAAGTACCCAGACGT
GGGCACTCGGGAGCAGCTGGCCAGGAAGGTGCACCTTCGGGAGGAGAAGGTGGAGGTCTGGTTTAAGAAC
CGCCGAGCCAAGTGGAGACGACAGAAGCGATCCTCCTCGGAGGAGTCAGAAAACGCCGAGAAGTGGAACA
AGACGTCCTCAAAAGCCTCGCCGGAGAAGAGGGAAGAGGAAGGTAAAAGCGATTTGGACTCGGACAGCTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_010351
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010351.1, NP_034481.1
RefSeq Size 1183 bp
RefSeq ORF 771 bp
Locus ID 14836
UniProt ID Q02591
Cytogenetics 12 54.32 cM
Gene Summary Regulates chordin (CHRD). May play a role in spatial programing within discrete embryonic fields or lineage compartments during organogenesis (By similarity). In concert with NKX3-2, plays a role in defining the structural components of the middle ear; required for the development of the entire tympanic ring. Goosecoid-expressing regions of the gastrulating mouse egg cylinder have organizer-like activity when transplanted into Xenopus embryos. Probably involved in the regulatory networks that define neural crest cell fate specification and determine mesoderm cell lineages in mammals (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.