Cmklr1 (NM_008153) Mouse Untagged Clone

CAT#: MC208581

Cmklr1 (untagged) - Mouse chemokine-like receptor 1 (Cmklr1), (10ug)


  "NM_008153" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Recombinant Anti-CMKLR1 (Clone BZ194)
    • 200 ug

USD 630.00

Other products for "Cmklr1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cmklr1
Synonyms ChemR23; DEZ; Gpcr27; mcmklr1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208581 representing NM_008153
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTACGACGCTTACAACGACTCCGGCATCTATGATGATGAGTACTCTGATGGCTTTGGCTACTTTG
TGGACTTGGAGGAGGCGAGTCCGTGGGAGGCCAAGGTGGCCCCGGTCTTCCTGGTGGTGATCTACAGCTT
GGTGTGCTTCCTCGGTCTCCTAGGCAACGGCCTGGTGATTGTCATCGCCACCTTCAAGATGAAGAAGACC
GTGAACACTGTGTGGTTTGTCAACCTGGCTGTGGCCGACTTCCTGTTCAACATCTTTTTGCCGATGCACA
TCACCTACGCGGCCATGGACTACCACTGGGTGTTCGGGAAGGCCATGTGCAAGATCAGCAACTTCTTGCT
CAGCCACAACATGTACACCAGCGTCTTCCTGCTGACTGTCATCAGCTTTGACCGCTGCATCTCCGTGCTG
CTCCCCGTCTGGTCCCAGAACCACCGCAGCATCCGCCTGGCCTACATGACCTGCTCGGCCGTCTGGGTCC
TGGCTTTCTTCTTGAGCTCCCCGTCCCTTGTCTTCCGGGACACCGCCAACATTCATGGGAAGATAACCTG
CTTCAACAACTTCAGCTTGGCCGCGCCTGAGTCCTCCCCACATCCCGCCCACTCGCAAGTAGTTTCCACA
GGGTACAGCAGACACGTGGCGGTCACTGTCACCCGCTTCCTTTGCGGCTTCCTGATCCCCGTCTTCATCA
TCACGGCCTGCTACCTTACCATCGTCTTCAAGCTGCAGCGCAACCGCCTGGCCAAGAACAAGAAGCCCTT
CAAGATCATTATCACCATCATCATCACCTTCTTCCTCTGCTGGTGCCCCTACCACACCCTCTACCTGCTG
GAGCTCCACCACACAGCTGTGCCAAGCTCTGTCTTCAGCCTGGGGCTACCCCTGGCCACGGCCGTCGCCA
TCGCCAACAGCTGCATGAACCCCATTCTGTACGTCTTCATGGGCCACGACTTCAGAAAATTCAAGGTGGC
CCTCTTCTCCCGCCTGGCCAACGCCCTGAGTGAGGACACAGGCCCCTCCTCCTACCCCAGTCACAGGAGC
TTCACCAAGATGTCGTCTTTGAATGAGAAGGCTTCGGTGAATGAGAAGGAGACCAGTACCCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008153
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC100612, AAI00613
RefSeq Size 2858 bp
RefSeq ORF 1116 bp
Locus ID 14747
UniProt ID P97468
Cytogenetics 5 F
Gene Summary Receptor for the chemoattractant adipokine chemerin/RARRES2 and for the omega-3 fatty acid derived molecule resolvin E1. Interaction with RARRES2 induces activation of intracellular signaling molecules, such as SKY, MAPK1/3 (ERK1/2), MAPK14/P38MAPK and PI3K leading to multifunctional effects, like reduction of immune responses, enhancing of adipogenesis and angionesis. Resolvin E1 down-regulates cytokine production in macrophages by reducing the activation of MAPK1/3 (ERK1/2) and NF-kappa-B (By similarity). Positively regulates adipogenesis and adipocyte metabolism.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.