Gfi1 (NM_010278) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Gfi1 |
Synonyms | AW495828; Gfi-1; Pal-1; Pal1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NM_010278.2
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGCGCTCATTCCTGGTCAAGAGCAAGAAGGCGCACAGCTATCACCAGCCGCGTTCTCCGGGGCCGG ACTACTCCCTGCGCCTGGAGACCGTGCCTGCGCCGGGCAGAGCAGAGGGCGGCGCTGTGAGTGCAGGCGA GTCGAAAATGGAGCCCCGAGAGCGTTTGTCCCCCGACTCTCAGCTTACCGAGGCTCCCGACAGGGCCTCC GCGTCCCCCAACAGCTGCGAAGGCAGCGTTTGTGACCCCTGCTCCGAGTTCGAGGACTTTTGGAGGCCCC CTTCTCCCTCCGTGTCTCCAGCGTCGGAGAAGTCACTGTGCCGCTCTCTGGACGAAGCCCAGCCCTACAC GCTGCCTTTCAAGCCCTATGCATGGAGCGGTCTTGCTGGGTCTGACCTGCGGCACCTGGTGCAGAGCTAT CGGCAGTGCAGCGCGCTGGAGCGCAGCGCGGGCCTGAGCCTCTTCTGCGAGCGCGGCTCGGAGCCGGGCC GCCCGGCAGCGCGCTACGGCCCCGAGCAGGCTGCGGGCGGAGCCGGTGCGGGACAGCCAGGGAGCTGCGG GGTCGCCGGGGGCGCCACCAGCGCTGCGGGCCTGGGGCTCTACGGCGACTTCGCGCCTGCGGCGGCCGGG CTGTACGAGCGGCCGAGCACAGCAGCAGGCCGGCTGTACCAAGATCATGGCCACGAGCTGCACGCGGACA AGAGCGTGGGCGTCAAGGTGGAGTCGGAGCTGCTTTGCACCCGTCTGCTGCTGGGCGGCGGCTCCTACAA ATGCATCAAATGCAGCAAGGTGTTCTCCACACCGCACGGGCTGGAGGTGCACGTGCGCCGGTCCCACAGC GGCACAAGACCCTTTGCGTGCGAGATGTGCGGCAAGACCTTCGGGCACGCGGTGAGCCTGGAGCAACACA AGGCAGTGCACTCCCAGGAACGCAGCTTTGACTGTAAGATCTGTGGCAAGAGCTTCAAGAGGTCATCCAC GCTGTCCACACATCTGCTCATTCACTCGGACACCCGGCCCTATCCCTGTCAGTACTGTGGCAAAAGATTC CACCAGAAGTCAGATATGAAGAAACACACCTTCATCCACACAGGTGAGAAGCCCCACAAATGCCAGGTGT GCGGCAAAGCCTTCAGTCAGAGCTCCAACCTCATCACTCATAGCAGAAAGCACACAGGCTTCAAGCCCTT TGGCTGTGACCTGTGTGGGAAGGGCTTCCAGAGGAAGGTGGATCTCAGGAGGCACCGAGAGACTCAGCAT GGACTCAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
Chromatograms
![]() Sequencher program is needed, download here |
Restriction Sites | SgfI-MluI |
ACCN | NM_010278 |
Insert Size | 1272 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_010278.2, NP_034408.1 |
RefSeq Size | 2862 bp |
RefSeq ORF | 1272 bp |
Locus ID | 14581 |
UniProt ID | P70338 |
Cytogenetics | 5 52.23 cM |
Summary | Transcription repressor essential for hematopoiesis. Functions in a cell-context and development-specific manner. Binds to 5'-TAAATCAC[AT]GCA-3' in the promoter region of a large number of genes. Component of several complexes, including the EHMT2-GFI1-HDAC1, AJUBA-GFI1-HDAC1 and RCOR-GFI-KDM1A-HDAC complexes, that suppress, via histone deacetylase (HDAC) recruitment, a number of genes implicated in multilineage blood cell development. Regulates neutrophil differentiation, promotes proliferation of lymphoid cells, and is required for granulocyte development. Mediates, together with U2AF1L4, the alternative splicing of CD45 and controls T-cell receptor signaling. Regulates the endotoxin-mediated Toll-like receptor (TLR) inflammatory response by antagonizing RELA. Cooperates with CBFA2T2 to regulate ITGB1-dependent neurite growth. Controls cell-cycle progression by repressing CDKNIA/p21 transcription in response to TGFB1 via recruitment of GFI1 by ZBTB17 to the CDKNIA/p21 and CDKNIB promoters. Required for the maintenance of inner ear hair cells.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG227196 | Gfi1 (tGFP-tagged) - Mouse growth factor independent 1 (Gfi1), (10ug) | 10 ug |
$886.00
|
|
MR227196 | Gfi1 (Myc-DDK-tagged) - Mouse growth factor independent 1 (Gfi1) | 10 ug |
$686.00
|
|
MR227196L3 | Lenti ORF clone of Gfi1 (Myc-DDK-tagged) - Mouse growth factor independent 1 (Gfi1) | 10 ug |
$986.00
|
|
MR227196L4 | Lenti ORF clone of Gfi1 (mGFP-tagged) - Mouse growth factor independent 1 (Gfi1) | 10 ug |
$986.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.