Drg1 (NM_007879) Mouse Untagged Clone

CAT#: MC208407

Drg1 (untagged) - Mouse developmentally regulated GTP binding protein 1 (Drg1), (10ug)


  "NM_007879" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Drg1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Drg1
Synonyms AA408859; AI132520; DRG-1; NEDD-3; Nedd3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208407 representing NM_007879
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGGGACCTTAGCGAAGATCGCGGAGATCGAAGCCGAGATGGCTCGGACTCAGAAGAACAAAGCCA
CAGCTCATCACCTTGGCCTGCTTAAGGCTCGCCTTGCTAAACTTCGAAGAGAACTCATCACTCCTAAAGG
TGGCGGCGGCGGGGGGCCAGGAGAAGGTTTTGATGTGGCCAAGACAGGTGATGCTCGAATTGGGTTTGTG
GGTTTTCCATCTGTGGGGAAATCAACTCTGCTAAGTAACTTAGCAGGAGTGTATTCTGAAGTGGCAGCCT
ATGAATTCACTACATTGACCACAGTGCCTGGTGTCATCAGATATAAAGGTGCCAAGATCCAGCTCCTGGA
TCTCCCGGGTATTATTGAAGGTGCCAAGGATGGGAAAGGTAGAGGTCGTCAAGTCATTGCAGTGGCCCGA
ACGTGTAATTTGATTTTGATTGTTCTGGATGTCCTAAAACCCTTGGGACATAAGAAGATAATTGAAAATG
AGTTGGAAGGCTTTGGGATTCGCTTGAACAGCAAACCCCCCAACATTGGCTTTAAGAAGAAAGACAAGGG
AGGCATTAACCTCACAGCCACTTGTCCTCAGAGTGAACTGGATGCTGAAACAGTGAAGAGCATTCTGGCT
GAATATAAGATTCATAATGCTGATGTGACTTTGCGTAGTGATGCCACAGCTGACGACCTCATTGACGTGG
TCGAAGGGAACAGAGTTTATATTCCCTGTATCTATGTATTAAATAAGATTGATCAGATCTCCATTGAGGA
GTTGGATATTATCTATAAGGTGCCTCACTGTGTACCCATCTCTGCTCATCACCGCTGGAATTTTGATGAC
CTTTTGGAGAAAATCTGGGACTATCTGAAACTAGTGAGAATTTACACCAAACCGAAAGGCCAGTTACCAG
ATTACACATCTCCAGTAGTGCTGCCTTATTCTAGGACCACTGTGGAAGATTTCTGCATGAAGATTCACAA
AAATCTCATCAAAGAATTTAAATATGCTTTGGTCTGGGGTCTGTCTGTGAAACATAATCCTCAGAAAGTG
GGTAAAGACCACACATTGGAAGATGAAGACGTCATTCAGATTGTGAAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007879
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007879.1, NP_031905.1
RefSeq Size 1524 bp
RefSeq ORF 1104 bp
Locus ID 13494
UniProt ID P32233
Cytogenetics 11 A1
Gene Summary Catalyzes the conversion of GTP to GDP through hydrolysis of the gamma-phosphate bond in GTP. Appears to have an intrinsic GTPase activity that is stimulated by ZC3H15/DFRP1 binding likely by increasing the affinity for the potassium ions. When hydroxylated at C-3 of 'Lys-22' by JMJD7, may bind to RNA and play a role in translation. Binds to microtubules and promotes microtubule polymerization and bundling that are required for mitotic spindle assembly during prophase to anaphase transition. GTPase activity is not necessary for these microtubule-related functions.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.