Bcl2l11 (NM_009754) Mouse Untagged Clone
CAT#: MC208191
Bcl2l11 (untagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3, (10ug)
"NM_009754" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Bcl2l11 |
Synonyms | 1500006F24Rik; bcl2-L-11; Bim; Bod |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NM_009754.3
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACAGAGAAGGTGGACAATTGCAGCCTGCTGAGA GGCCTCCCCAGCTCAGGCCTGGGGCCCCTACCTCCCTACAGACAGAACCGCAAGCTTCCATACGACAGTC TCAGGAGGAACCTGAAGATCTGCGCCCGGAGATACGGATTGCACAGGAGCTGCGGCGGATCGGAGACGAG TTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGG TTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009754 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009754.3, NP_033884.1 |
RefSeq Size | 4782 bp |
RefSeq ORF | 333 bp |
Locus ID | 12125 |
UniProt ID | O54918 |
Cytogenetics | 2 F1 |
Gene Summary | Induces apoptosis and anoikis. The isoforms vary in cytotoxicity with isoform BimS being the most potent and isoform BimEL being the least potent.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223081 | Bcl2l11 (tGFP-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11) transcript variant 3, (10ug) |
USD 350.00 |
|
MR223081 | Bcl2l11 (Myc-DDK-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 |
USD 150.00 |
|
MR223081L3 | Lenti ORF clone of Bcl2l11 (Myc-DDK-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 |
USD 450.00 |
|
MR223081L4 | Lenti ORF clone of Bcl2l11 (mGFP-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review