Bcl2l11 (NM_009754) Mouse Untagged Clone

SKU
MC208191
Bcl2l11 (untagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3, (10ug)
$150.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Bcl2l11
Synonyms 1500006F24Rik; bcl2-L-11; Bim; Bod
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NM_009754.3
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACAGAGAAGGTGGACAATTGCAGCCTGCTGAGA
GGCCTCCCCAGCTCAGGCCTGGGGCCCCTACCTCCCTACAGACAGAACCGCAAGCTTCCATACGACAGTC
TCAGGAGGAACCTGAAGATCTGCGCCCGGAGATACGGATTGCACAGGAGCTGCGGCGGATCGGAGACGAG
TTCAACGAAACTTACACAAGGAGGGTGTTTGCAAATGATTACCGCGAGGCTGAAGACCACCCTCAAATGG
TTATCTTACAACTGTTACGCTTTATCTTCCGTCTGGTATGGAGAAGGCATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_009754
Insert Size 333 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009754.3, NP_033884.1
RefSeq Size 4782 bp
RefSeq ORF 333 bp
Locus ID 12125
UniProt ID O54918
Cytogenetics 2 F1
Summary Induces apoptosis and anoikis. The isoforms vary in cytotoxicity with isoform BimS being the most potent and isoform BimEL being the least potent.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1.
Write Your Own Review
You're reviewing:Bcl2l11 (NM_009754) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG223081 Bcl2l11 (tGFP-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11) transcript variant 3, (10ug) 10 ug
$350.00
MR223081 Bcl2l11 (Myc-DDK-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 10 ug
$289.00
MR223081L3 Lenti ORF clone of Bcl2l11 (Myc-DDK-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 10 ug
$450.00
MR223081L4 Lenti ORF clone of Bcl2l11 (mGFP-tagged) - Mouse BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 3 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.