Ager (NM_007425) Mouse Untagged Clone
SKU
MC208117
Ager (untagged) - Mouse advanced glycosylation end product-specific receptor (Ager), (10ug)
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Ager |
Synonyms | RAGE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_007425, the custom clone sequence may differ by one or more nucleotides
ATGCCAGCGGGGACAGCAGCTAGAGCCTGGGTGCTGGTTCTTGCTCTATGGGGAGCTGTAGCTGGTGGTC AGAACATCACAGCCCGGATTGGAGAGCCACTTGTGCTAAGCTGTAAGGGGGCCCCTAAGAAGCCGCCCCA GCAGCTAGAATGGAAACTGAACACAGGAAGAACTGAAGCTTGGAAGGTCCTCTCTCCCCAGGGAGGCCCC TGGGACAGCGTGGCTCGAATCCTCCCCAATGGTTCCCTCCTCCTTCCAGCCACTGGAATTGTCGATGAGG GGACTTTCCGGTGTCGGGCAACTAACAGGCGAGGGAAGGAGGTCAAGTCCAACTACCGAGTCCGAGTCTA CCAGATTCCTGGGAAGCCAGAAATTGTGGATCCTGCCTCTGAACTCACAGCCAGTGTCCCTAATAAGGTG GGGACATGTGTGTCTGAGGGAAGCTACCCTGCAGGGACCCTTAGCTGGCACTTAGATGGGAAACTTCTGA TTCCCGATGGCAAAGAAACACTCGTGAAGGAAGAGACCAGGAGACACCCTGAGACGGGACTCTTTACACT GCGGTCAGAGCTGACAGTGATCCCCACCCAAGGAGGAACCCATCCTACCTTCTCCTGCAGTTTCAGCCTG GGCCTTCCCCGGCGCAGACCCCTGAACACAGCCCCCATCCAACTCCGAGTCAGGGAGCCTGGGCCTCCAG AGGGCATTCAGCTGTTGGTTGAGCCTGAAGGTGGAATAGTCGCTCCTGGTGGGACTGTGACCTTGACCTG TGCCATCTCTGCCCAGCCCCCTCCTCAGGTCCACTGGATAAAGGATGGTGCACCCTTGCCCCTGGCTCCC AGCCCTGTGCTGCTCCTCCCTGAGGTGGGGCACGAGGATGAGGGCACCTATAGCTGCGTGGCCACCCACC CTAGCCACGGACCTCAGGAAAGCCCTCCTGTCAGCATCAGGGTCACAGAAACCGGCGATGAGGGGCCAGC TGAAGGCTCTGTGGGTGAGTCTGGGCTGGGTACGCTAGCCCTGGCCTTGGGGATCCTGGGAGGCCTGGGA GTAGTAGCCCTGCTCGTCGGGGCTATCCTGTGGCGAAAACGACAACCCAGGCGTGAGGAGAGGAAGGCCC CGGAAAGCCAGGAGGATGAGGAGGAACGTGCAGAGCTGAATCAGTCAGAGGAAGCGGAGATGCCAGAGAA TGGTGCCGGGGGACCGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007425 |
Insert Size | 1209 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | BC061182, AAH61182 |
RefSeq Size | 1399 bp |
RefSeq ORF | 1209 bp |
Locus ID | 11596 |
UniProt ID | Q62151 |
Cytogenetics | 17 B1 |
Summary | Mediates interactions of advanced glycosylation end products (AGE). These are nonenzymatically glycosylated proteins which accumulate in vascular tissue in aging and at an accelerated rate in diabetes. Acts as a mediator of both acute and chronic vascular inflammation in conditions such as atherosclerosis and in particular as a complication of diabetes. AGE/RAGE signaling plays an important role in regulating the production/expression of TNF-alpha, oxidative stress, and endothelial dysfunction in type 2 diabetes. Interaction with S100A12 on endothelium, mononuclear phagocytes, and lymphocytes triggers cellular activation, with generation of key proinflammatory mediators. Interaction with S100B after myocardial infarction may play a role in myocyte apoptosis by activating ERK1/2 and p53/TP53 signaling. Can also bind oligonucleotides. Receptor for amyloid beta peptide. Contributes to the translocation of amyloid-beta peptide (ABPP) across the cell membrane from the extracellular to the intracellular space in cortical neurons. ABPP-initiated RAGE signaling, especially stimulation of p38 mitogen-activated protein kinase (MAPK), has the capacity to drive a transport system delivering ABPP as a complex with RAGE to the intraneuronal space. RAGE-dependent signaling in microglia contributes to neuroinflammation, amyloid accumulation, and impaired learning/memory in a mouse model of Alzheimer disease.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG206306 | Ager (tGFP-tagged) - Mouse advanced glycosylation end product-specific receptor (Ager) | 10 ug |
$886.00
|
|
MR206306 | Ager (Myc-DDK-tagged) - Mouse advanced glycosylation end product-specific receptor (Ager) | 10 ug |
$686.00
|
|
MR206306L3 | Lenti ORF clone of Ager (Myc-DDK-tagged) - Mouse advanced glycosylation end product-specific receptor (Ager) | 10 ug |
$986.00
|
|
MR206306L4 | Lenti ORF clone of Ager (mGFP-tagged) - Mouse advanced glycosylation end product-specific receptor (Ager) | 10 ug |
$986.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.