Tnf (NM_013693) Mouse Untagged Clone

CAT#: MC208048

Tnf (untagged) - Mouse tumor necrosis factor (Tnf), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tnf
• Synonyms: DI; DIF; Tn; TNF-; TNF-a; TNF-alpha; Tnfa; TNFalpha; Tnfs; Tnfsf1a; TNFSF2; Tnlg1f
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208048 representing NM_013693
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCACAGAAAGCATGATCCGCGACGTGGAACTGGCAGAAGAGGCACTCCCCCAAAAGATGGGGGGCT
  TCCAGAACTCCAGGCGGTGCCTATGTCTCAGCCTCTTCTCATTCCTGCTTGTGGCAGGGGCCACCACGCT
  CTTCTGTCTACTGAACTTCGGGGTGATCGGTCCCCAAAGGGATGAGAAGTTCCCAAATGGCCTCCCTCTC
  ATCAGTTCTATGGCCCAGACCCTCACACTCAGATCATCTTCTCAAAATTCGAGTGACAAGCCTGTAGCCC
  ACGTCGTAGCAAACCACCAAGTGGAGGAGCAGCTGGAGTGGCTGAGCCAGCGCGCCAACGCCCTCCTGGC
  CAACGGCATGGATCTCAAAGACAACCAACTAGTGGTGCCAGCCGATGGGTTGTACCTTGTCTACTCCCAG
  GTTCTCTTCAAGGGACAAGGCTGCCCCGACTACGTGCTCCTCACCCACACCGTCAGCCGATTTGCTATCT
  CATACCAGGAGAAAGTCAACCTCCTCTCTGCCGTCAAGAGCCCCTGCCCCAAGGACACCCCTGAGGGGGC
  TGAGCTCAAACCCTGGTATGAGCCCATATACCTGGGAGGAGTCTTCCAGCTGGAGAAGGGGGACCAACTC
  AGCGCTGAGGTCAATCTGCCCAAGTACTTAGACTTTGCGGAGTCCGGGCAGGTCTACTTTGGAGTCATTG
  CTCTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_013693
• Insert Size: 708 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_013693.2, NP_038721.1
• RefSeq Size: 1653 bp
• RefSeq ORF: 708 bp
• Locus ID: 21926
• UniProt ID: P06804
• Cytogenetics: 17 18.59 cM
• Gene Summary: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).