Rack1 (NM_008143) Mouse Untagged Clone
CAT#: MC208014
Gnb2l1 (untagged) - Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 (Gnb2l1), (10ug)
"NM_008143" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rack1 |
Synonyms | AL033335; GB-like; Gnb2-rs1; Gnb2l1; p205 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208014 representing NM_008143
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCGAGCAGATGACCCTTCGCGGGACCCTTAAGGGCCACAATGGATGGGTAACACAGATCGCCACCA CACCGCAGTTCCCGGACATGATCCTGTCTGCGTCTCGAGACAAGACCATCATCATGTGGAAGCTGACCAG AGATGAGACCAACTATGGCATACCACAGCGTGCTCTGAGAGGTCACTCCCACTTCGTTAGTGATGTTGTT ATCTCCTCTGATGGTCAGTTTGCCCTCTCGGGCTCCTGGGACGGAACGCTGCGCCTCTGGGATCTCACAA CGGGCACCACCACAAGGCGATTTGTCGGCCACACCAAGGATGTGTTGAGCGTGGCCTTCTCCTCTGACAA CCGGCAGATTGTCTCTGGGTCCCGAGACAAGACCATAAAGTTATGGAATACTCTGGGTGTCTGCAAGTAC ACGGTCCAGGATGAGAGTCATTCAGAATGGGTGTCTTGTGTCCGCTTCTCCCCGAACAGCAGCAACCCTA TCATCGTCTCCTGCGGATGGGACAAGCTGGTCAAGGTGTGGAATCTGGCTAACTGCAAGCTAAAGACCAA CCACATTGGCCACACTGGCTACCTGAACACAGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGA GGCAAGGATGGCCAGGCTATGCTGTGGGATCTCAATGAAGGCAAGCACCTCTACACTTTAGATGGTGGGG ACATCATCAATGCCTTGTGCTTCAGCCCCAACCGCTACTGGCTCTGCGCTGCCACTGGCCCCAGCATCAA GATCTGGGACTTGGAGGGCAAGATCATTGTAGATGAATTGAAGCAAGAAGTTATCAGCACCAGCAGCAAG GCAGAGCCACCCCAGTGTACCTCTTTGGCATGGTCTGCTGATGGCCAGACTCTGTTTGCTGGCTATACAG ACAACTTGGTGCGAGTATGGCAGGTAACTATTGGTACCCGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008143 |
Insert Size | 954 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008143.3, NP_032169.1 |
RefSeq Size | 1254 bp |
RefSeq ORF | 954 bp |
Locus ID | 14694 |
UniProt ID | P68040 |
Cytogenetics | 11 B1.2 |
Gene Summary | Scaffolding protein involved in the recruitment, assembly and/or regulation of a variety of signaling molecules. Interacts with a wide variety of proteins and plays a role in many cellular processes. Component of the 40S ribosomal subunit involved in translational repression. Involved in the initiation of the ribosome quality control (RQC), a pathway that takes place when a ribosome has stalled during translation, by promoting ubiquitination of a subset of 40S ribosomal subunits (By similarity). Binds to and stabilizes activated protein kinase C (PKC), increasing PKC-mediated phosphorylation. May recruit activated PKC to the ribosome, leading to phosphorylation of EIF6. Inhibits the activity of SRC kinases including SRC, LCK and YES1. Inhibits cell growth by prolonging the G0/G1 phase of the cell cycle. Enhances phosphorylation of BMAL1 by PRKCA and inhibits transcriptional activity of the BMAL1-CLOCK heterodimer. Facilitates ligand-independent nuclear translocation of AR following PKC activation, represses AR transactivation activity and is required for phosphorylation of AR by SRC. Modulates IGF1R-dependent integrin signaling and promotes cell spreading and contact with the extracellular matrix. Involved in PKC-dependent translocation of ADAM12 to the cell membrane. Promotes the ubiquitination and proteasome-mediated degradation of proteins such as CLEC1B and HIF1A. Required for VANGL2 membrane localization, inhibits Wnt signaling, and regulates cellular polarization and oriented cell division during gastrulation. Required for PTK2/FAK1 phosphorylation and dephosphorylation. Regulates internalization of the muscarinic receptor CHRM2. Promotes apoptosis by increasing oligomerization of BAX and disrupting the interaction of BAX with the anti-apoptotic factor BCL2L. Inhibits TRPM6 channel activity. Regulates cell surface expression of some GPCRs such as TBXA2R. Plays a role in regulation of FLT1-mediated cell migration. Involved in the transport of ABCB4 from the Golgi to the apical bile canalicular membrane (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204575 | Gnb2l1 (tGFP-tagged) - Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 (Gnb2l1) |
USD 500.00 |
|
MR204575 | Gnb2l1 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 (Gnb2l1) |
USD 300.00 |
|
MR204575L3 | Lenti ORF clone of Gnb2l1 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 (Gnb2l1) |
USD 600.00 |
|
MR204575L4 | Lenti ORF clone of Gnb2l1 (mGFP-tagged) - Mouse guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 (Gnb2l1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review