Ppif (NM_134084) Mouse Untagged Clone

CAT#: MC207815

Ppif (untagged) - Mouse peptidylprolyl isomerase F (cyclophilin F) (Ppif), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_134084" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ppif"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ppif
Synonyms AW457192; CyP-D; CyP-F; CypD; PPIase
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207815 representing NM_134084
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTAGCGCTGCGTTGCGGCCCCCGCCTGCTCGGTCTGCTCTCCGGCCCGCGCTCCGCGCCGCTGCTCC
TCTCCGCGACCCGTACCTGCAGCGACGGCGGAGCCCGCGGCGCGAACTCTTCCTCCGGGAACCCGCTCGT
GTACTTGGACGTGGGCGCCGATGGACAGCCGCTCGGCCGCGTGGTGCTGGAGTTAAAGGCAGATGTCGTG
CCAAAGACTGCAGAGAACTTCAGAGCCCTATGCACTGGTGAGAAGGGCTTTGGCTACAAAGGCTCCACCT
TCCACAGGGTGATCCCAGCCTTCATGTGCCAGGCTGGCGACTTCACCAACCACAATGGCACAGGAGGGAG
GTCCATCTACGGAAGCCGCTTTCCCGACGAGAACTTCACACTGAAGCATGTGGGGCCAGGTGTCCTGTCC
ATGGCGAACGCAGGCCCCAACACCAATGGCTCTCAGTTCTTTATCTGCACGATAAAGACAGACTGGCTAG
ATGGCAAGCATGTCGTGTTCGGCCATGTCAAAGAGGGCATGGATGTTGTGAAGAAAATAGAATCTTTCGG
CTCAAAAAGTGGGAAGACGTCTAAGAAGATTGTCATCACAGACTGTGGCCAGTTGAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_134084
Insert Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_134084.1, NP_598845.1
RefSeq Size 1560 bp
RefSeq ORF 621 bp
Locus ID 105675
UniProt ID Q99KR7
Cytogenetics 14 A3
Gene Summary PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Involved in regulation of the mitochondrial permeability transition pore (mPTP). It is proposed that its association with the mPTP is masking a binding site for inhibiting inorganic phosphate (Pi) and promotes the open probability of the mPTP leading to apoptosis or necrosis; the requirement of the PPIase activity for this function is debated. In cooperation with mitochondrial TP53 is involved in activating oxidative stress-induced necrosis. Involved in modulation of mitochondrial membrane F(1)F(0) ATP synthase activity and regulation of mitochondrial matrix adenine nucleotide levels. Has anti-apoptotic activity independently of mPTP and in cooperation with BCL2 inhibits cytochrome c-dependent apoptosis.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.