Pus1 (NM_001025562) Mouse Untagged Clone

CAT#: MC207521

Pus1 (untagged) - Mouse pseudouridine synthase 1 (Pus1), transcript variant 3, (10ug)


  "NM_001025562" in other vectors (3)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-Pus1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pus1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pus1
Synonyms A730013B20Rik; MPUS1; mPus1p
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207521 representing NM_001025562
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGGAAACAAGGTGCCACCAGCGCTGGCCTCACACCAACCGGACAGGAAGGGCCGAGGTGGCTGGG
TCTGGGAGGAGACGGAGCATCCTGCAAAGAGGGTCAAGGGCGGCGAGGATGAAGAGCCCCCACGCAAGCT
GCCAAAGCGAAAAATTGTGCTGCTCATGGCCTACTCGGGCAAGGGCTACCACGGCATGCAGAGGAATCTG
GGGTCCTCCCAGTTCAGGACCATCGAAGATGACTTGGTATCGGCCTTAGTCCAGGCAGGTTGTATCCCTG
AAAACCATGGCACAGATATGAGGAAGATGTCCTTCCAGCGGTGTGCTCGAACAGACAAGGGTGTGTCTGC
AGCAGGGCAGGTGGTATCCCTAAAGGTGTGGCTGATTGATGACATTCTGGACAAGATCAACAGCCACCTT
CCATCCCACATTCGGATTCTGGGATTGAAGAGGGTCACAGGCGGGTTCAACTCCAAGAACAAGTGTGACG
CCAGGACCTACTGCTACATGCTGCCCACCTTTGCCTTTGCTCACAAGGACCGGGATGTACAGGACGAGAG
CTATCGCCTGAGTGCAGAGACCCTGCAGCAGGTCAACCGCCTTCTGGCCTGCTACAAAGGCACCCATAAC
TTCCATAACTTCACCTCGCAGAAGGGCCCAAGAGAGCCCAGTGCGCGCCGCTACATTCTGGAGATGTACT
GCGAAGAGCCCTTCGTACGTGAGGGCCTGGAGTTTGCTGTGATCAAGGTGAAGGGCCAGAGCTTCATGAT
GCACCAGATCCGGAAGATGGTTGGCCTGGTGGTAGCCATTGTGAAGGGTTATGCCCCTGAGAGTGTCCTG
GAGCGCAGCTGGGGAGAGGAGAAGGTGGATGTGCCCAAGGCACCCGGGCTTGGCTTAGTCCTGGAGAGGG
TTCACTTTGAAAAGTACAATCAACGCTTTGGCGGTGACGGGCTGCATGAGCCCCTGGACTGGACGCAGGA
GGAAGGGAAGGTGACTGCTTTCAAGGAGCAGTACATTTACCCTACCATTGTCAGCACTGAGCGGGATGAG
CGGTCCATGGCCCAGTGGCTCAATACTTTGCCGATCCACAACTTCAGTGGCACTGCACTTGGAGCGGCTG
ACACAGGTGCCAAGGTCCCCAGTTCCCTGGAGGGCAGTGAAGGGGATGGAGACACTGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025562
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025562.2, NP_001020733.1
RefSeq Size 1535 bp
RefSeq ORF 1182 bp
Locus ID 56361
UniProt ID Q9WU56
Cytogenetics 5 F
Gene Summary Converts specific uridines to PSI in a number of tRNA substrates. Acts on positions 27/28 in the anticodon stem and also positions 34 and 36 in the anticodon of an intron containing tRNA (PubMed:10094309). Involved in regulation of nuclear receptor activity possibly through pseudouridylation of SRA1 RNA (PubMed:15327771). Isoforms 3 and 4 do not form pseudouridine when expressed in vitro (PubMed:11085940).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR and 5' coding region and lacks an in-frame segment in the coding region, as compared to variant 1. These differences cause translation initiation at a downstream AUG and an encoded protein (isoform 3) that is shorter than isoform 1. Variants 3 and 6 both encode the same isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.