Rnf144b (NM_001170643) Mouse Untagged Clone

CAT#: MC206979

Rnf144b (untagged) - Mouse ring finger protein 144B (Rnf144b), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rnf144b
• Synonyms: BC025007; E130105P19Rik; Ibrdc2; Pir2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206979 representing NM_001170643.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGACTCCGTCGATGGGCTCCAGTGTCTGACCATGACTGCGGAAAACCCACCCTCTGGAGACCTGATT
  CCCGCCCCGCTCGTCACTTGCAAGCTCTGCCTGTGTGAACAGTCTCTGGACAAGATGACCATGCTCCAA
  GAGTGCCAGTGTATCTTTTGTACACCCTGCCTGAAACAGTATATGGTGCTGTCAATCCGAGAAGGCTGT
  GGATCTCCTATCACTTGTCCTGACATGGTGTGCCTAAACCACGGGACCCTGCAGGAAACCGAGATTGCC
  TGTTTGGTGCCTCTGGATGAGTTTCAGCTGTATCAGCGGCTCAAGTTTGAACGAGAGGTTCACATGGAC
  CCCCTCCGGACATGGTGTCCTGTTGCAGACTGCCAGACCGTGTGCCATATTTCAGCCGGAGACCCAGGC
  CAGCCAGTGTTGGTGGAGTGCCCTTCTTGCCACCTGAAATTCTGCTCATGTTGCAAGGATGCTTGGCAC
  GAGGAGTCTTCCTGTAGAGACAGCCAGTCGGCGATGCCAGAGCATGGGGCTCTCTTTGGAACGGATGCG
  GACGCCCCCATCAAGCAGTGCCCGGTTTGCCGCATTTACATTGAGCGCAACGAAGGCTGCGCCCAGATG
  ATGTGCAAGAACTGCAAGCACACATTTTGCTGGTACTGTCTGCAGAACCTGGACAATGACATATTCCTC
  AGGCACTATGACAAAGGGCCATGCAGGAATAAGCTCGGCCACTCGAGGGCATCGGTAATGTGGAACCGA
  ACACAGGTAGTGGGGATCCTTGTGGGATTAGGTGTCATTGCCTTGGTGACCTCACCCTTGCTGCTCCTG
  GCCTCTCCCTGTATAATCTGCTGTGTCTGCAAGTCCTGTCGCGGCAAGAAGAAAAAGCATGATCCATCC
  ACAACCTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001170643
• Insert Size: 906 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001170643.1
• RefSeq Size: 4540 bp
• RefSeq ORF: 906 bp
• Locus ID: 218215
• UniProt ID: Q8BKD6
• Cytogenetics: 13 A5
• MW: 33.5 kDa
• Gene Summary: E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes UBE2L3 and UBE2L6 in the form of a thioester and then directly transfers the ubiquitin to targeted substrates such as LCMT2, thereby promoting their degradation. Induces apoptosis via a p53/TP53-dependent but caspase-independent mechanism. However, its overexpression also produces a decrease of the ubiquitin-dependent stability of BAX, a pro-apoptotic protein, ultimately leading to protection of cell death; But, it is not an anti-apoptotic protein per se (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.