N6amt1 (BC098330) Mouse Untagged Clone

CAT#: MC206917

N6amt1 (untagged) - Mouse N-6 adenine-specific DNA methyltransferase 1 (putative) (cDNA clone MGC:106447 IMAGE:30548526), complete, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: N6amt1
• Synonyms: 5830445C04Rik; Hemk2; Pred28
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206917 representing BC098330.
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGCGCCGAGTGTCCCCACGCCGTTGTACGGGCACGTGGGTCGCGGAGCCTTCCGCGACGTGTAC
  GAGCCAGCGGAGGACACGTTCCTGTTACTGGACGCGCTCGAGGCGGCGGCGGCCGAGCTAGCAGGAGTG
  GAAATATGCCTTGAAGTAGGAGCAGGATCTGGTGTGGTGTCTGCATTCCTGGCCTCCATGATAGGTCCT
  CGGGCCTTATACATGTACACTGATATCAACCCTGAGGCAGCCGCATGTACCTTGGAAACAGCACGCTGT
  AACAGAGTCCATGTTCAGCCAGTGATCACAGATTTGGTGCACGGCTTGCTGCCCAGACTGAAGGGGAAA
  GTAGACCTGCTGGTGTTTAACCCCCCCTATGTAGTGACTCCGCCTGAAGAGGTAAGACTCACAACAGAA
  CTCAGTCTTTGTTCCCAGCTGTTTCACGAGACCAAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: BC098330
• Insert Size: 453 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC098330
• RefSeq Size: 3489 bp
• RefSeq ORF: 452 bp
• Locus ID: 67768
• Cytogenetics: 16 C3.3
• MW: 16.1 kDa
• Gene Summary: Methyltransferase that can methylate both proteins and DNA, and to a lower extent, arsenic (PubMed:20606008, PubMed:26797129). Catalytic subunit of a heterodimer with TRMT112, which catalyzes N5-methylation of Glu residue of proteins with a Gly-Gln-Xaa-Xaa-Xaa-Arg motif (PubMed:26797129). Methylates ETF1 on 'Gln-185'; ETF1 needs to be complexed to ERF3 in its GTP-bound form to be efficiently methylated (PubMed:20606008, PubMed:26797129). Also acts as a N(6)-adenine-specific DNA methyltransferase by mediating methylation of DNA on the 6th position of adenine (N(6)-methyladenosine) (By similarity). N(6)-methyladenosine (m6A) DNA is significantly enriched in exonic regions and is associated with gene transcriptional activation (By similarity). May also play a role in the modulation of arsenic-induced toxicity by mediating the conversion of monomethylarsonous acid (3+) into the less toxic dimethylarsonic acid (By similarity). It however only plays a limited role in arsenic metabolism compared with AS3MT (By similarity).[UniProtKB/Swiss-Prot Function]