Ing5 (BC064674) Mouse Untagged Clone
CAT#: MC206898
Ing5 (untagged) - Mouse inhibitor of growth family, member 5 (cDNA clone MGC:66742 IMAGE:6400183), (10ug)
"BC064674" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ing5 |
Synonyms | 1700001C14Rik; 1700027H23Rik; 1810018M11Rik; AI225768 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206898 representing BC064674.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGACCTACGAGATGGTGGATAAACACATCCGAAGACTTGATGCTGACCTGGCGCGCTTTGAGGCT GACCTGAAGGACAGGATGGATGGAAGTGACTTTGAGAGCACTGGAGCACGGAGCTTGAAAAAAGGCCGG AGTCAGAAAGAAAAAAGAAGCTCCCGGGGCCGAGGCCGGCGGACGTCAGAAGAGGATACCCCAAAGAAG AAGAAACATAAAAGCGGGTCTGAGTTTACTGACAGTATCCTATCTGTGCACCCCTCTGATGTGCTGGAC ATGCCTGTGGATCCGAATGAGCCTACATACTGCTTGTGCCACCAGGTGTCCTACGGGGAGATGATCGGC TGTGACAATCCAGATTGTCCCATTGAGTGGTTTCACTTTGCCTGCGTGGATCTCACCACAAAGCCCAAA GGAAAGTGGTTTTGTCCACGATGTGTTCAGGAAAAGAGGAAGAAGAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC064674 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC064674 |
RefSeq Size | 4579 bp |
RefSeq ORF | 464 bp |
Locus ID | 66262 |
Cytogenetics | 1 D |
MW | 17.8 kDa |
Gene Summary | Component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Component of the MOZ/MORF complex which has a histone H3 acetyltransferase activity. May function as a transcriptional coactivator for RUNX2. Inhibits cell growth, induces a delay in S-phase progression and enhances Fas-induced apoptosis in an INCA1-dependent manner (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201124 | Ing5 (tGFP-tagged) - Mouse inhibitor of growth family, member 5 (cDNA clone MGC:66742 IMAGE:6400183) |
USD 350.00 |
|
MR201124 | Ing5 (Myc-DDK-tagged) - Mouse inhibitor of growth family, member 5 (cDNA clone MGC:66742 IMAGE:6400183) |
USD 150.00 |
|
MR201124L3 | Lenti ORF clone of Ing5 (Myc-DDK-tagged) - Mouse inhibitor of growth family, member 5 (cDNA clone MGC:66742 IMAGE:6400183) |
USD 450.00 |
|
MR201124L4 | Lenti ORF clone of Ing5 (mGFP-tagged) - Mouse inhibitor of growth family, member 5 (cDNA clone MGC:66742 IMAGE:6400183) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review