1110005A23Rik (BC027510) Mouse Untagged Clone
CAT#: MC206894
1110005A23Rik (untagged) - Mouse RIKEN cDNA 1110005A23 gene (cDNA clone MGC:41057 IMAGE:1382354), (10ug)
"BC027510" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | 1110005A23Rik |
Synonyms | 1110005A23Rik; Cip29 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206894 representing BC027510.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCCGAGACGGTGGAGCTCCACAAGCTGAAGCTTGCTGAACTAAAGCAAGAATGTCTTGCTCGT GGTTTAGAGACCAAGGGAATAAAACAAGATCTTATAAATAGGCTGCAGGCCTATCTTGAAGACCATGCA GAAGAAGAAGCAAATGAAGAAGATGTACTGGGAGATGAAACTGAGGAAGAAGAACCAAAGCCCATAGAA CTGCCTGTTAAAGAGGAAGAACCTCCTGAAAAGGCTGTTGATATGGCATCGGAAAAGAAGGTGGTAAAG ATTACATCTGGGATACCTCAGACTGAAAGAATGCAGAAGAGGGCTGAACGATTCAATGTACCTGTAAGC CTGGAGAGTAAGAAGGCTGCCCGGGCGGCTAGGTTTGGAATTTCTTCAGTTCCAACAAAAGGTTTATCA TCTGACACCAAGCCTATGGTTAACCTGGATAAACTAAAGGAAAGAGCACAGAGATTTGGTTTGAATGTC TCTTCCATCTCTAGAAAGTCTGAGGATGATGAGAAGCTGAAGAAACGGAAGGAGAGATTTGGGATTGTG ACAAGTTCAGCTGGAACTGGAACCACAGAGGATACAGAGGCAAAGAAAAGAAAAAGAGCAGAGCGTTTT GGAATTGCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC027510 |
Insert Size | 633 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027510 |
RefSeq Size | 908 bp |
RefSeq ORF | 632 bp |
Locus ID | 66118 |
Cytogenetics | 10 D3 |
MW | 23.5 kDa |
Gene Summary | Binds both single-stranded and double-stranded DNA with higher affinity for the single-stranded form. Specifically binds to scaffold/matrix attachment region DNA. Also binds single-stranded RNA. Enhances RNA unwinding activity of DDX39A. May participate in important transcriptional or translational control of cell growth, metabolism and carcinogenesis. Component of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NFX1 pathway (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202272 | 1110005A23Rik (tGFP-tagged) - Mouse RIKEN cDNA 1110005A23 gene (cDNA clone MGC:41057 IMAGE:1382354) |
USD 500.00 |
|
MR202272 | 1110005A23Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110005A23 gene (cDNA clone MGC:41057 IMAGE:1382354) |
USD 300.00 |
|
MR202272L3 | Lenti ORF clone of 1110005A23Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110005A23 gene (cDNA clone MGC:41057 IMAGE:1382354) |
USD 600.00 |
|
MR202272L4 | Lenti ORF clone of 1110005A23Rik (mGFP-tagged) - Mouse RIKEN cDNA 1110005A23 gene (cDNA clone MGC:41057 IMAGE:1382354) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review