I1C0022H11Rik (XM_001002654) Mouse Untagged Clone

CAT#: MC205976

I1C0022H11Rik (untagged) - PREDICTED: Mouse RIKEN cDNA I1C0022H11 gene (I1C0022H11Rik), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name I1C0022H11Rik (XM_001002654) Mouse Untagged Clone
Symbol I1C0022H11Rik
Vector pCMV6-Kan/Neo
Sequence Data
>NCBI ORF sequence for XM_001002654, the custom clone sequence may differ by one or more nucleotides


ATGGATGCATTGACCTTTGATGATGTGCATGTACACTTCACTCGGGAGGAGTGGTCCTTGCTGGATCCAT
CTCAGAAGAGACTTTACAAAGATGTCATGCTGGAGAACTACAGGAATCTCACCGCTATAGGCTACAATTG
GAAAGACCATAACATTGAAGAACATTGTCAAAATGATAGAAGATATGGAAGGCACAAAATCACTCCTGCT
GGAGAGAAACCCTATGAATATACACAATGGGATAAAGCCTTCAAATATCACAGTCATCTTCAAAAGCTTG
AAAGAAACCAAACTGGAGACAAAAACTCTGAAGTCTTTCAACATAGTAAAGTGCTTGCATGTCAAAGTAC
TCTACAAAGAAATAAAAGAACAAATACTGGAGAGAAACCCTACAAACCCAGCTATCTTCGAATGCATGAA
AGAACACATACTGGAGAGAAACCTTACCAATGTAATGAATGTGATAAAGCCTTTTTACAGCTCAGGTATC
TTAGATTACATGAAAGAAGACATAGTGGAGAGAAACCCTATGAATGTAATCAATGTGGTAAAGCCTTTTT
ACATCTCAACTATCTTAGAATTCATGAAAGAACACATACTGGAGAGAAACCTTACCAATGTAATCAATGT
GGTAAAGCCTTTACACAAAGGAGTCATCTTCAAAGACATAAAGTAGTACATACTGGAGTGAGACCCTACA
TATGTAATCAGTGTAATAAAGCCTACCCACAGCAGAATTATCTCCGAAAACATGAAAGAACACATACTGG
AGAGAAACCTTATATATGTAACCAGTGTAATAAAGCCTTTTCACACCAGAGTAATCTCCGAATACATGAA
AAGACACATACAGGTGAGAAACCCTATAAATGTAATCAGTGTGATAAAGCCTTTTCACACCAGAGTAATC
TCCAAATACATGAAAGAACACATACAGGTGAGAAACCCTATAAATGTAATCAGTGTGATAAAGCCTTTGC
ACACCTCAAGTATCTTCGAGCACATGAAAGAACACATACTCAAGAGAAACCATACAAATGTAATCAATGT
GGTAAAGCTTTTTTATATCTCAGCTGTCTTCGGGTACATGAAAGAACACATACTGGAGAGAAACCTTATA
AATGTAATCAGTGTGATAAAGCCTTTGCACACCTCAAGTATCTTCGAGCACATGAAAGAATACATACTCA
AGAGAAACCCTACAAATGTAATCAATGTGGTAAAGCCTTTTTACTTCTCAGCTGTCTTCGGGTACATGAA
AGAACACATACTGGAGAGAAACCTTACAAATGTGATCAATGTGGTAAGGCTTTTACACAACGCAGTCATC
TTAAAACCCATAAAGTAATACATACTGGAGGGAGACTCTAA


Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN XM_001002654
ORF Size 1317 bp
Insert Size 1317
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC066874, XP_001002654
RefSeq Size 2877
RefSeq ORF 1317
Locus ID 668620
Cytogenetics 7|7 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.