Arg2 (NM_009705) Mouse Untagged Clone

SKU
MC204188
Arg2 (untagged) - Mouse arginase type II (Arg2), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Arg2
Synonyms AII; AU022422
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC023349
GTTGCACCGAGCCGGTTCTCCTAGGGTAATCCCCTCCCTGCCAATCATGTTCCTGAGGAGCAGCGCCTCC CGTCTCCTCCACGGGCAAATTCCTTGCGTCCTGACGAGATCCGTCCACTCTGTAGCTATAGTCGGAGCCC CTTTCTCTCGGGGACAGAAGAAGCTAGGAGTGGAATATGGTCCAGCTGCCATTCGAGAAGCTGGCTTGCT GAAGAGGCTCTCCAGGTTGGGATGCCACCTAAAAGACTTTGGAGACTTGAGTTTTACTAATGTCCCACAA GATAATCCCTACAATAATCTGGTTGTGTATCCTCGTTCAGTGGGCCTTGCCAACCAGGAACTGGCTGAAG TGGTTAGTAGAGCTGTGTCAGGTGGCTACAGCTGTGTCACCATGGGAGGAGACCACAGCCTGGCAATAGG TACCATTATCGGTCACGCCCGGCACCGCCCAGATCTCTGTGTCATCTGGGTTGATGCTCATGCGGACATT AATACACCTCTCACCACTGTATCTGGAAATATACATGGACAGCCACTTTCCTTTCTCATCAAAGAACTAC AAGACAAGGTACCACAACTGCCAGGATTTTCCTGGATCAAACCTTGCCTCTCTCCCCCAAATATTGTGTA CATTGGCCTGAGAGATGTGGAGCCTCCTGAACATTTTATTTTAAAGAATTATGACATCCAGTATTTTTCC ATGAGAGAGATTGATCGACTTGGGATCCAGAAGGTGATGGAACAGACATTTGATCGGCTGATTGGCAAAA GGCAGAGGCCAATCCACCTGAGTTTTGATATTGATGCATTTGACCCTAAATTGGCTCCAGCCACAGGAAC CCCTGTTGTAGGGGGATTAACCTACAGAGAAGGAGTGTATATTACTGAAGAAATACATAATACAGGGTTG CTGTCAGCTCTGGATCTTGTTGAAGTCAATCCTCATTTGGCCACTTCTGAGGAAGAGGCCAAGGCAACAG CCAGACTAGCAGTGGATGTGATTGCTTCAAGTTTTGGTCAGACAAGAGAAGGAGGACACATTGTCTATGA CCACCTTCCTACTCCTAGTTCACCACACGAATCAGAAAATGAAGAATGTGTGAGAATTTAGGAAATACTG TACTCTGGCACCTTTCACAACAGCATTCCAGAGTTGCAAGGCATTCGAAGGGACAGATATGAAATGGCTG TCTGGATCAATATTGCCTTAATGAGAACATCTGTGCACTCTCACAACTGTAAAACTCCCTTCTCTATTTT GGTCACCAACACTATTACTGTAAATGTATTTTTTGTTGTTTTTGAAGTTTACAAGCTATTAATGTTATAC ATGTAAGTTTGAAGGAGTCATAAACAACATTTATTACCTTAGTATATCATAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_009705
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC023349, AAH23349
RefSeq Size 1396 bp
RefSeq ORF 1065 bp
Locus ID 11847
UniProt ID O08691
Cytogenetics 12 C3
Summary May play a role in the regulation of extra-urea cycle arginine metabolism and also in down-regulation of nitric oxide synthesis. Extrahepatic arginase functions to regulate L-arginine bioavailability to nitric oxid synthase (NOS). Arginine metabolism is a critical regulator of innate and adaptive immune responses. Seems to be involved in negative regulation of the survival capacity of activated CD4(+) and CD8(+) T cells (PubMed:27745970, PubMed:25009204). May suppress inflammation-related signaling in asthmatic airway epithelium (PubMed:27214549). May contribute to the immune evasion of H.pylori by restricting M1 macrophage activation and polyamine metabolism (PubMed:27074721). May play a role in promoting prenatal immune suppression (By similarity). Regulates RPS6KB1 signaling, which promotes endothelial cell senescence and inflammation and implicates NOS3/eNOS dysfunction (PubMed:22928666). Can inhibit endothelial autophagy independently of its enzymatic activity implicating mTORC2 signaling (PubMed:25484082). Involved in vascular smooth muscle cell senescence and apoptosis independently of its enzymatic activity (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Arg2 (NM_009705) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG205396 Arg2 (tGFP-tagged) - Mouse arginase type II (Arg2) 10 ug
$657.00
MR205396 Arg2 (Myc-DDK-tagged) - Mouse arginase type II (Arg2) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205396L3 Lenti ORF clone of Arg2 (Myc-DDK-tagged) - Mouse arginase type II (Arg2) 10 ug
$757.00
MR205396L4 Lenti ORF clone of Arg2 (mGFP-tagged) - Mouse arginase type II (Arg2) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.