Cep120 (NM_178686) Mouse Untagged Clone

CAT#: MC203364

Cep120 (untagged) - Mouse centrosomal protein 120 (Cep120), (10ug)

  View "NM_178686" in other vectors (6)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Cep120 (NM_178686) Mouse Untagged Clone
Symbol Cep120
Synonyms A230075C01; AU016693; Ccdc100
Vector pCMV6-Kan/Neo
Sequence Data
>BC053439
CGGCGGCGTCCGCTGCGGCTGCCCGGGCGTTTGAATAGCGGCTTAGCAGGCGGCAAAAAGACCCTGCCGC CGCGACCATGGTCCCCAAGTCCGACCAACTGCTCATCGTCGTATCCATCCTCGAAGGTCGCCATTTCCCC AAACGTCCAAAGCATCTGCTCGTGGTGGAAGCAAAGTTTGATGGGGAGCAGCTGGCTACTGATCCTGTCG ACCATACTGACCAGCCAGAATTTGCTACTGAGCTAGCCTGGGAGATTGACAGGAAAGTCCTTCATCAGCA CCGGTTACAGCGCACGCCGATCAAACTCCAGTGCTTTGCCTTGGACCCGCAGACTTCTGCCAAGGAAACC GTAGGCTACATTGTTTTGGACTTAAGAACAGCTCAAGAAACAAAGCAGGCTCCCAAATGGTACCAGCTGC TGAGTAACAAATACACCAAGTTCAAGGCCGAGGTGCAGATCAGCCTCACTTTGGAGACAGATACAAAGGC CCAGGTGGATAGTTATAAAGCAAAAGCAGCCCCGCCTCGGGATGGAAAAGTTCTTGCTAGCCTGGCAGGA GTTGACCCGAAGGACATTGTTGCAGTATTGAATGAGGAAGGAGGCTACCATCAGATTGGACCAGCGGAGC ACTGTACTGACCCCTTTATTTTGTCGGTGACGATTGCATTTGCCACCCAGTTGGAACAGTTAATTCCATG TACCATGAAGCTTCCAGAAAGGCAGCCTGAGTTTTTCTTTTACTATTCTTTACTGGGAAACGATGTTACA AACGAGCCTTTCAGTGATTTGATCAACCCAAACTTTGAGCCCGAGAGGGCATCTGTTCGTATACGCAGCA GTGTGGAGATTCTGCGTGTGTACCTGGCTCTTCACTCTAAACTGCAGATCCATCTCTGCTGTGGAGACCA GTCACTTGGCAGTACAGAAATACCTTTAAATGGATTACTGAAGAAGGGCAGTACAGAGATTAACCAGCAT CCGGTCACAGTAGAAGGTGCTTTTACCCTTGACCCTCCAAACCGAGCCAAGCAGAAGCTAGCTCCAGTCC CTCTGGACCTGGCCCCAACTGTGGGCGTGTCCGTGGCTCTGCAGAGAGAAGGCATCGATTCCCAGTCTTT AATTGAATTAAAGACCCAGAATGGACATGAGGCAGAACATTCACAGAAGAGAGTTTTAACCCCCATAAAG GAGAAGACACTCACTGGGCCAAAATCACCAAGGGAGTCCCCTGCCCCGCCCCCACCTCCAAACCAGACGC CTCCAACCAAGGATGATGCAACAGAAAGTGAAGTGGAGAGCCTGCAGTATGACAAGGATCCAAAGCCCAC TGTGAAGGGCATCGGTTCTGTACCTGCTTCGCTGGCCCAGCCAGAGGCCACCTGTGGTGCGTCAGAAGTG GTGACATCAGGACAGAAGATTGCTGTTCCAGCGGCGTCACACCACTTCTGCTTCTCAGTAGACTTAAGAA GCGTCCATGACTTGGAACTCAGTTTTCCAGTCAACTGCATATTGAGGTACTCCTACCCATTCTTCGGCAG TGCAGCTCCTATTATGACTAACCCTCCCGTAGAAGTTCGGAAAAACATGGAGGTTTTTCTTCCTCAGTCT TACTGTGCGTTTGATTTTGCAACTATGCCTCACCAGCTCCAAGACACCTTCCTACGGATTCCTCTGCTGG TGGAGTTATGGCACAAGGATAAAATGAGTAAAGATTTACTCCTTGGGGTCGCAAGAATCCAGCTTTCTAA TATCTTGTCTTCAGAAAAGACCCGGTTTTTAGGTGCTAATGGTGAGCAGTGCTGGCGACAGACGTACAGT GAGAGCGTGCCTGTGATAGCAGCCCAGGGGTCAAATAACAGGATATTAGACCTTTCTTATACAATGACAC TGGAAGACTATGGCCTAGTGAAAATGCGTGAGATCTTTGTATCGGAGTCATCTCAGGGTGTGCCTGCTGT GGATCAGAAGCCATCTTCGCCTCCTCCCGCTCCCTGCCCTTCTGAGATCCAGATGGAACCCAGAGAGACC TTAGAGTACAAGGCTGCCCTCGAGCTGGAGATGTGGAAAGAGATGCAGGAAGACATATTTGAAAGTCAGC TGAAGCAAAAAGAACTGGCTCACATGCAAGCTCTTGCAGAAGAGTGGAAAAAAAGGGACCGGGAAAGAGA GTCACTAGTGAAGAAAAAGGTAGCTGAATACAGTATTCTAGAAGGCAAACTTCAGAAGGCCCTCACGGAG CTAGAGACCCGTGAGCAGCAGCTGGCCAGTGCAGAAGCAGAGCTTCAGAGAGAGAGAAAGGAGCTGCAGT TAGAACGGGAGCGGAACCTTCAAGAGCTGCAGGACTCTGTCCGAAGGGCCAGAGACGACTGTGTGTACCA AGTGGAGCTGGAGAGGCTGAAGCTGAAGCAGCTGGAAGAGGACAAACAGCGGCTTCAGCAGCAGCTTAAT GATGCTGGCAATAAGTATAAGACTTTGGAAAAAGAGTTTCAGCAGTTCAAGGATCAACAGAACAACAAAC CAGAAATCCGGCTGCAGTCAGAAATAAACCTCCTCACCTTGGAGAAGGTTGAACTTGAAAGAAAGTTGGA ATCTGCAACCAAGTCTAAACTGCATTACAAGCAGCAGTGGGGCCGAGCTTTGAAAGAACTTGCCAGACTA AAGCAGAGGGAGCAAGAAAGTCAAATGGCCCGCCTTAAAAAACAGCAGGAGGAGTTGGAGCAGATGCGGC TGCGTTACCTGGCGGCTGAGGAGAAAGAAACAGTGAGAACTGAGCAGCAGGAACTGCTGGATATAAGGAA CGAGCTGAACAGGTTAAGGCAGCAAGAACAGAACCAGTACCAGGACTGCAAAGAGATTGCAAGTGGGAAG CTGGGCAGCCCGAGGGGCTCTGGGCTGGAAGAAGGCTTGGATGACTACCTGACACGCCTGATAGAGGAAA GGGACACTCTGATGAGAACGGGTGTCTATAACCATGAGGACCGCATAATAAGTGAACTCGACCGGCAGAT CAGAGAGGTTTTGACCAAAAACAGTGCCAGTTAAAAACCACCGGGGAAACGTTTGCAGATACGCTAGGTC TGCAGTTTGATATTTTGTAAAATCCTCAAAAGCAAGGGAAGTGGCTACTTTGGAATGCTCTTTATAATTT TTATAAGCTGAATTTTATATGTTACTGTATATAGTATTTATTTGATTTTACTTACGCTACCTCTCCAATG CTGGCTTCATTTTAATTGTGTTTTATATGCTCATTTAAAATGACTTTTCAGTGTTCTTCAGTTTAAAATC TGTTGTTTGACTTTAAAAACAGCCTTTCACAACTTGTCCCAGGAGAACTGACCACAGTAGTTCCCACTGT ATAATTTTTATGTTGAGCCAAGAGAGAATATGTTGCACTTTAAACACGCTGTGTCCTGCTCCCTTTGAGT GTAGATATCTTCAAGTTGAAGCCAATTATAAGTGTAGCCATTTTTAAAAAGCATTTATATGACCAGTCTT TTTCCCCTCAACCTGTGGTATTTGCAGATGACAACTTTGAAAATAAAGCAGTCTCGGGCAGAGACGCTGT GTGACATGTTGGCTGACAAATTAGTCATTGCTTAAACACAGTTCATGCAGATTAAACACAAATCAAGTTC CAAATTTCATTGGACTCCACTTGAAGACCATGAGAAAATAGCTTGGTCTGACCACAATCTCCTGCTCATG ACTCTCTGAGGCTTCTTGTTAAAATGGTTGCCTTTGTTTCTCAGTGATAGCGATACAGCTCAGGAATGGA CTATGGAAACTGATACCTAGCGACATTAGCTGAGAACACCACGGAGCTGCTTCCCTCCCTCTGCAGTCAG TCTGTTTTCAGAGGCACCCCAGCGAGCCCAGTGCAAGCCCGTAACCCTCCAGAGCTCCTTCACACTGCGC TCTCCAAACCACCCCATCCTCACAGCGAGCTTATCCCTACCTCTGCGTGACACTGAGCAGGCAGATTAGC AATCTCCCAGGTCATGCAGCATCTTGAAACAAAGTAAGAATTCTGATTCCCAAAAATAACAAATTTAAGT GTATACTTTAGCAGGTGTGTACTAATTACCAGTAACTTCAACACAAGCAAAGCAGGTTACATGGTAATGT TCATTCAGTATATTTCTTGTTTGTGAAATTGAAACCTCTATAGGCATCATATGCTTCTTGTCTTTAACAA AGTCTTTGTCTTCTAAGAGCAACCCCGCAGTAAACAACAGAGGGGTTGCTGGACTTGAGGGTGACGAGAC AGATGATCATAGCAGGGATTTGAAATATGAATTATGGTTACATGGTCCTGATTTTTTTTTTTTGGTGACA TGAATGGAACAGAAGTATTTTGTTTTAGAAGGTCCTGGCCCAGCGTTGGTTCTTCCTCCTGTATCCTGTG AGGCCTGGAGCTTTTCAAACACTAGAGGGGGCCTTAGAGTAAGTGGAAAGGACTTCTAAAATGTGTGTGT GCTTTGCCTTCCAGAAAGCCATCTTTGGGCTACTGTAATATGACAAATAAAATCCTCACTGTGTGCATCC TTGAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_178686
ORF Size 2967 bp
Insert Size 2967
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC053439, NP_848801
RefSeq Size 4572
RefSeq ORF 2967
Locus ID 225523
Cytogenetics 18|18 D1

Other Versions

Other products for "Cep120"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies