Bmp7 (NM_007557) Mouse Untagged Clone

CAT#: MC201085

Bmp7 (untagged) - Mouse bone morphogenetic protein 7 (Bmp7), (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Bmp7 (NM_007557) Mouse Untagged Clone
Symbol Bmp7
Synonyms OP1
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC010771 sequence for NM_007557
GTCCTGGCGAGTGCGGGCCGAGGGGCCCCGGGCCAGAACTGAGTAAAGGACAGGGGCGTCCCGGGCAAAG CGCAGCCGGCCGGGGAGTGGCCATGTGTGGCGAGGCCGCCTTGAAGCTCGCCTGCAGCAAGTGACCTCGG GTCGTGGACCGCTGCCCTGCCCCCTCCGCTGCCACCTGGGGCGGCGCGGGCCCGGTGCCCCGGATCGCGC GTAGAGCCGGCGCGATGCACGTGCGCTCGCTGCGCGCTGCGGCGCCACACAGCTTCGTGGCGCTCTGGGC GCCTCTGTTCTTGCTGCGCTCCGCCCTGGCCGATTTCAGCCTGGACAACGAGGTGCACTCCAGCTTCATC CACCGGCGCCTCCGCAGCCAGGAGCGGCGGGAGATGCAGCGGGAGATCCTGTCCATCTTAGGGTTGCCCC ATCGCCCGCGCCCGCACCTCCAGGGAAAGCATAATTCGGCGCCCATGTTCATGTTGGACCTGTACAACGC CATGGCGGTGGAGGAGAGCGGGCCGGACGGACAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACC CAGGGCCCCCCTTTAGCCAGCCTGCAGGACAGCCACTTCCTCACTGACGCCGACATGGTCATGAGCTTCG TCAACCTAGTGGAACATGACAAAGAATTCTTCCACCCTCGATACCACCATCGGGAGTTCCGGTTTGATCT TTCCAAGATCCCCGAGGGCGAAGCGGTGACCGCAGCCGAATTCAGGATCTATAAGGACTACATCCGGGAG CGATTTGACAACGAGACCTTCCAGATCACAGTCTATCAGGTGCTCCAGGAGCACTCAGGCAGGGAGTCGG ACCTCTTCTTGCTGGACAGCCGCACCATCTGGGCTTCTGAGGAGGGCTGGTTGGTGTTTGATATCACAGC CACCAGCAACCACTGGGTGGTCAACCCTCGGCACAACCTGGGCTTACAGCTCTCTGTGGAGACCCTGGAT GGGCAGAGCATCAACCCCAAGTTGGCAGGCCTGATTGGACGGCATGGACCCCAGAACAAGCAACCCTTCA TGGTGGCCTTCTTCAAGGCCACGGAAGTCCATCTCCGTAGTATCCGGTCCACGGGGGGCAAGCAGCGCAG CCAGAATCGCTCCAAGACGCCAAAGAACCAAGAGGCCCTGAGGATGGCCAGTGTGGCAGAAAACAGCAGC AGTGACCAGAGGCAGGCCTGCAAGAAACATGAGCTGTACGTCAGCTTCCGAGACCTTGGCTGGCAGGACT GGATCATTGCACCTGAAGGCTATGCTGCCTACTACTGTGAGGGAGAGTGCGCCTTCCCTCTGAACTCCTA CATGAACGCCACCAACCACGCCATCGTCCAGACACTGGTTCACTTCATCAACCCAGACACAGTACCCAAG CCCTGCTGTGCGCCCACCCAGCTCAACGCCATCTCTGTCCTCTACTTCGACGACAGCTCTAATGTCATCC TGAAGAAGTACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAGCTCTTCCTGAGACCCTGACCTTT GCGGGGCCACACCTTTCCAAATCTTCGATGTCTCACCATCTAAGTCTCTCACTGCCCACCTTGGCGAGGA GCCAACAGACCAACCTCTCCTGAGCCTTCCCCTCACCTCCCCAACCGGAAGCATGTAAGGGTTCCAGAAA CCTGAGCGTGCAGGCAGCTGATGAGCGCCCTTTCCTTCTGGCACGTGACGGACAAGATCCTACCAGCTAC CACAGCAAACGCCTAAGAGCAGGAAAAATGTCTGCCAGGAAAGTGTCCATTGGCCACATGGCCCCTGGCG CTCTGAGTCTTTGAGGAGTAATCGCAAGCCTCGTTCAGCTGCAGCAGAAGGAAGGGCTTAGCCAGGGTGG GCGCTGGCGTCTGTGTTGAAGGGAAACCAAGCAGAAGCCACTGTAATGATATGTCACAATAAAACCCATG AATGAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_007557
ORF Size 1293 bp
Insert Size 1293
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC010771, NP_031583
RefSeq Size 1987
RefSeq ORF 1293
Locus ID 12162
Cytogenetics 2 H3|2 95.54 cM
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. Mutation of this gene results in skeletal, kidney, and other developmental defects. [provided by RefSeq, Jul 2016].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.