Aadat (NM_011834) Mouse Untagged Clone

CAT#: MC200934

Aadat (untagged) - Mouse aminoadipate aminotransferase (Aadat), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Aadat (NM_011834) Mouse Untagged Clone
Symbol Aadat
Synonyms Aadt; AI875679; Kat2; KATII; Kyat2; mKat-2
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC012637 sequence for NM_011834
CCACGCGTCCGGGTGGCACTACACAGGGACAGCTAACAGTGCATCCCGAGTGACTGGCTTTCTGAATCCT GCTCCACGCGACCAGCAGAGACATGAATTACTCACGGTTCCTCACTGCAACGAGCCTGGCCAGAAAGCCA TCTCCCATCAGAACTACAGCGGACATACTGAGCAAAGCACCAAAAACCCTCATCTCCCTGGCTCCTGGAT CTCCAAACCCGAGCATGTTCCCCTTTAAGTCAGCTGCCTTCACTGTGGAAAACGGAAGCACCATCCGGTT TGAAGACGACTTGATCAAAAGGGCCCTCCAATACTCTCCAAGCTATGGAATTCCAGAACTTCTGTCCTGG CTAAAACAGTTTCAAGTAAAATTGCATAATCCCCCCACTGTCAACTACCCACCCAATCAAGGACAGATGG ATCTCTGCATCACATCTGGCTGCCAAGATGGTCTCTGTAAGGCATTTGAAATGCTCATCAATCCTGGAGA CACTATCCTGGTCAATGAACCACTGTTTCCAGGAACCCTTTATGCTATGAAACCACTAGGCTGCAACATT ATTAATGTCCCCAGTGATGAGCATGGGATTATTCCAGAGGGTCTCAAAAAAATCCTTTCCCAGTGGAAAC CAGAAGATTCCAAGGATCCCACAAAAAAGACTCCAAAATTTCTGTATACTGTCCCAAATGGCAACAACCC TACAGGCAACTCGTTGACAGGTGACCGCAAGAAGGAAATCTATGAGCTTGCAAGAAAATATGATTTCCTC ATAATAGAAGATGACCCTTACTATTTTCTTCAGTTTAGCAAGCCTTGGGAGCCAACTTTTCTCTCCATGG ATGTTGATGGGAGAGTCATCAGAGCTGACACCTTTTCAAAAACCGTCTCCTCAGGGTTGAGAGTAGGGTT TATGACTGGCCCTAAGACCTTGATACAGAATATTGTTCTCCACACACAAGTCTCATCAGTACATGCCTGT ACTCTCTCACAGCTCATGATACTACAGCTTCTACACCAATGGGGAGAAGAGGGTTTCCTGGCTCATATTG ACAGAACTATTGATTTCTACAAGAACCAGAGGGATTCCATATTGGCAGCTGCAGACAAGTGGTTACGTGG CTTGGCAGAGTGGCATGTTCCCAAAGCTGGCATGTTTCTATGGATTAAAGTTAAGGGAATCTCCGATACA AAACAACTGATTGAAGAAAAGGCTATTGAAAGAGAGGTCTTACTTGTTCCTGGAAATGGTTTCTTCATTG ATGGCTCAGCTCCTACCTCCTTCTTCAGAGCATCCTTCTCTCTGGCTACTCCAGCACAGATGGATACAGC CTTCCAGAGATTGGCCCAACTGATAAAAGAGTCTTTATGAAGAAATCAAACTCAGCATTGGACTCATAAT TTTTAAATAAATTACTTCTGTACTTTGCAGAAGAAATGGTTGTTGCTGTTTGACTGACAGGATGGATCCA GGTTGTGAAACATCTGTAGCAATTTCCCTGAACCACTTTAAAGTCCCCTTAAATCCATCACATTGCCAAA TAGCTTTCTGATCTACTTTTGCCCTTTGATTAATTTGCAACTGACAAAGCATTAAATTTTATTGTAAAGA GCTCTATAGCTGCTTTATAATAGCCAATAAATTTTTTTCAAAACTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_011834
ORF Size 1278 bp
Insert Size 1278
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC012637, NP_035964
RefSeq Size 1670
Locus ID 23923
Cytogenetics 8 B3.1|8 30.85 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations