Atg5 (NM_053069) Mouse Untagged Clone

SKU
MC200308
Atg5 (untagged) - Mouse autophagy-related 5 (yeast) (Atg5), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Atg5
Synonyms 2010107M05Rik; 3110067M24Rik; Ap; Apg5l; Atg5l; AW319544; C88337; Pad; Paddy
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC002166 sequence for NM_053069
CTGCGCCTCTGCAGGACAGTGTGATCCCGGCAGACAGAACCCGACCGAGCGGCTTTCGCGCTGCGGGAAG CCGGAGCAGAGCCGGCACCTCGGTTTGGCTTTGGTTGAAGGAAGAACTTAGCCTATATGTACTGCTTCAT CCACTGGAAGAATGACAGATGACAAAGATGTGCTTCGAGATGTGTGGTTTGGACGAATTCCAACTTGCTT TACTCTCTATCAGGATGAGATAACTGAAAGAGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTCAGC TATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGATGTTAGTG AGATATGGTTTGAATATGAAGGCACACCCCTGAAATGGCATTATCCAATTGGTTTACTATTTGATCTTCT TGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTCAAGAGTTTTCCAGAAAAGGACCTTCTA CACTGTCCATCCAAGGATGCGGTTGAGGCTCACTTTATGTCGTGTATGAAAGAAGCTGATGCTTTAAAGC ATAAAAGTCAAGTGATCAACGAAATGCAGAAAAAAGACCACAAGCAGCTCTGGATGGGACTGCAGAATGA CAGATTTGACCAGTTTTGGGCCATCAACCGGAAACTCATGGAATATCCTCCAGAAGAAAATGGATTTCGT TATATCCCCTTTAGAATATATCAGACCACGACGGAGCGGCCTTTCATCCAGAAGCTGTTCCGGCCTGTGG CCGCAGATGGACAGCTGCACACACTTGGAGATCTCCTCAGAGAAGTCTGTCCTTCCGCAGTCGCCCCTGA AGATGGAGAGAAGAGGAGCCAGGTGATGATTCACGGGATAGAGCCAATGCTGGAAACCCCTCTGCAGTGG CTGAGCGAGCATCTGAGCTACCCAGATAACTTTCTTCATATTAGCATTGTCCCCCAGCCAACAGATTGAA AGAGTGTGTCCTCCTCGCTAGATGGAACCACCTTGAGTCAGGACAACGAGGCGTGACACCCTTGCTTCAG TCAAGTTCAGTGGAGGCAACAGAAACCCGGGCTGCTGCAAGCCAAGGAGGAGAAGATTCCATGAGAGATA GGGCGCCCGGGCAGGGCTGAGTGTGCACCACTGCTTCGCTGAGACACACAGGACCACTGCAGCCTCCTCT TCTCGTGAAATGCAATGCAGCCGAAGCCTTTGCTCAATGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_053069
Insert Size 828 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC002166, AAH02166
RefSeq Size 1244 bp
RefSeq ORF 828 bp
Locus ID 11793
UniProt ID Q99J83
Cytogenetics 10 23.24 cM
Summary The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Two transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Atg5 (NM_053069) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203691 Atg5 (tGFP-tagged) - Mouse autophagy-related 5 (yeast) (Atg5) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR203691 Atg5 (Myc-DDK-tagged) - Mouse autophagy-related 5 (yeast) (Atg5) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR203691L3 Lenti ORF clone of Atg5 (Myc-DDK-tagged) - Mouse autophagy-related 5 (yeast) (Atg5) 10 ug
$600.00
MR203691L4 Lenti ORF clone of Atg5 (mGFP-tagged) - Mouse autophagy-related 5 (yeast) (Atg5) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.