COX2(PTGS2) (NM_000963) Human 3' UTR Clone

CAT#: SC219115

3`UTR clone of prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 845.00


Availability*
1 Week

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name COX2(PTGS2) (NM_000963) Human 3' UTR Clone
Vector pMirTarget
Symbol PTGS2
Synonyms COX-2; COX2; GRIPGHS; hCox-2; PGG/HS; PGHS-2; PHS-2
ACCN NM_000963
Insert Size 2559
Sequence Data
Insert Sequence
>SC219115 3'UTR clone of NM_000963
The sequence shown below is from the reference sequence of NM_000963. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACGTTCGACTGAACTGTAGAAGTCTAATGATCATATTTATTTATTTATATGAACCATGTCTATTAATTTA
ATTATTTAATAATATTTATATTAAACTCCTTATGTTACTTAACATCTTCTGTAACAGAAGTCAGTACTCC
TGTTGCGGAGAAAGGAGTCATACTTGTGAAGACTTTTATGTCACTACTCTAAAGATTTTGCTGTTGCTGT
TAAGTTTGGAAAACAGTTTTTATTCTGTTTTATAAACCAGAGAGAAATGAGTTTTGACGTCTTTTTACTT
GAATTTCAACTTATATTATAAGAACGAAAGTAAAGATGTTTGAATACTTAAACACTGTCACAAGATGGCA
AAATGCTGAAAGTTTTTACACTGTCGATGTTTCCAATGCATCTTCCATGATGCATTAGAAGTAACTAATG
TTTGAAATTTTAAAGTACTTTTGGTTATTTTTCTGTCATCAAACAAAAACAGGTATCAGTGCATTATTAA
ATGAATATTTAAATTAGACATTACCAGTAATTTCATGTCTACTTTTTAAAATCAGCAATGAAACAATAAT
TTGAAATTTCTAAATTCATAGGGTAGAATCACCTGTAAAAGCTTGTTTGATTTCTTAAAGTTATTAAACT
TGTACATATACCAAAAAGAAGCTGTCTTGGATTTAAATCTGTAAAATCAGTAGAAATTTTACTACAATTG
CTTGTTAAAATATTTTATAAGTGATGTTCCTTTTTCACCAAGAGTATAAACCTTTTTAGTGTGACTGTTA
AAACTTCCTTTTAAATCAAAATGCCAAATTTATTAAGGTGGTGGAGCCACTGCAGTGTTATCTTAAAATA
AGAATATTTTGTTGAGATATTCCAGAATTTGTTTATATGGCTGGTAACATGTAAAATCTATATCAGCAAA
AGGGTCTACCTTTAAAATAAGCAATAACAAAGAAGAAAACCAAATTATTGTTCAAATTTAGGTTTAAACT
TTTGAAGCAAACTTTTTTTTATCCTTGTGCACTGCAGGCCTGGTACTCAGATTTTGCTATGAGGTTAATG
AAGTACCAAGCTGTGCTTGAATAATGATATGTTTTCTCAGATTTTCTGTTGTACAGTTTAATTTAGCAGT
CCATATCACATTGCAAAAGTAGCAATGACCTCATAAAATACCTCTTCAAAATGCTTAAATTCATTTCACA
CATTAATTTTATCTCAGTCTTGAAGCCAATTCAGTAGGTGCATTGGAATCAAGCCTGGCTACCTGCATGC
TGTTCCTTTTCTTTTCTTCTTTTAGCCATTTTGCTAAGAGACACAGTCTTCTCATCACTTCGTTTCTCCT
ATTTTGTTTTACTAGTTTTAAGATCAGAGTTCACTTTCTTTGGACTCTGCCTATATTTTCTTACCTGAAC
TTTTGCAAGTTTTCAGGTAAACCTCAGCTCAGGACTGCTATTTAGCTCCTCTTAAGAAGATTAAAAGAGA
AAAAAAAAGGCCCTTTTAAAAATAGTATACACTTATTTTAAGTGAAAAGCAGAGAATTTTATTTATAGCT
AATTTTAGCTATCTGTAACCAAGATGGATGCAAAGAGGCTAGTGCCTCAGAGAGAACTGTACGGGGTTTG
TGACTGGAAAAAGTTACGTTCCCATTCTAATTAATGCCCTTTCTTATTTAAAAACAAAACCAAATGATAT
CTAAGTAGTTCTCAGCAATAATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATT
TAATGGTACTGTATATTACTTAATTTATTGAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATA
AACTGTGTTTAAGCCTACAATCATTGATTTTTTTTTGTTATGTCACAATCAGTATATCTTCTTTGGGGTT
ACCTCTCTGAATATTATGTAAACAATCCAAAGAAATGATTGTATTAAGATTTGTGAATAAATTTTTAGAA
ATCTGATTGGCATATTGAGATATTTAAGGTTGAATGTTTGTCCTTAGGATAGGCCTATGTGCTAGCCCAC
AAAGAATATTGTCTCATTAGCCTGAATGTGCCATAAGACTGACCTTTTAAAATGTTTTGAGGGATCTGTG
GATGCTTCGTTAATTTGTTCAGCCACAATTTATTGAGAAAATATTCTGTGTCAAGCACTGTGGGTTTTAA
TATTTTTAAATCAAACGCTGATTACAGATAATAGTATTTATATAAATAATTGAAAAAAATTTTCTTTTGG
GAAGAGGGAGAAAATGAAATAAATATCATTAAAGATAACTCAGGAGAATCTTCTTTACAATTTTACGTTT
AGAATGTTTAAGGTTAAGAAAGAAATAGTCAATATGCTTGTATAAAACACTGTTCACTGTTTTTTTTAAA
AAAAAAACTTGATTTGTTATTAACATTGATCTGCTGACAAAACCTGGGAATTTGGGTTGTGTATGCGAAT
GTTTCAGTGCCTCAGACAAATGTGTATTTAACTTATGTAAAAGATAAGTCTGGAAATAAATGTCTGTTTA
TTTTTGTACTATTTAAAAATTGACAGATCTTTTCTGAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000963.2
Synonyms COX-2; COX2; GRIPGHS; hCox-2; PGG/HS; PGHS-2; PHS-2
Summary Prostaglandin-endoperoxide synthase (PTGS), also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. This gene encodes the inducible isozyme. It is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. [provided by RefSeq, Feb 2009]
Locus ID 5743
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents