ORP150(HYOU1) (NM_006389) Human 3' UTR Clone

CAT#: SC214544

3`UTR clone of hypoxia up-regulated 1 (HYOU1) transcript variant 1 for miRNA target validation

Change vector?

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ORP150(HYOU1) (NM_006389) Human 3' UTR Clone
Vector pMirTarget
Symbol HYOU1
Synonyms GRP-170; Grp170; HSP12A; ORP-150; ORP150
ACCN NM_006389
Insert Size 1407
Sequence Data
Insert Sequence
>SC214544 3'UTR clone of NM_006389
The sequence shown below is from the reference sequence of NM_006389. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCTTTGAAGAACGACGAACTATAACCCCCACCTCTGTTTTCCCCATTCATCTCCACCCCCTTCCCCCAC
CACTTCTATTTATTTAACATCGAGGGTTGGGGGAGGGGTTGGTCCTGCCCTCGGCTGGAGTTCCTTTCTC
ACCCCTGTGATTTGGAGGTGTGGAGAAGGGGAAGGGAGGGACAGCTCACTGGTTCCTTCTGCAGTACCTC
TGTGGTTAAAAATGGAAACTGTTCTCCTCCCCAGCCCCACTCCCTGTTCCCTACCCATATAGGCCCTAAA
TTTGGGAAAAATCACTATTAATTTCTGAATCCTTTGCCTGTGGGTAGGAAGAGAATGGCTGCCAGTGGCT
GATGGGTCCCGGTGATGGGAAGGGTATCAGGTTGCTGGGGAGTTTCCACTCTTCTCTGGTGATTGTTCCT
TCCCTCCCTTCCTCTCCCACCATGCGATGAGCATCCTTTCAGGCCAGTGTCTGCAGAGCCTCAGTTACCA
GGTTTGGTTTCTGAGTGCCTATCTGTGCTCTTTCCTCCCTCTGCGGGCTTCTCTTGCTCTGAGCCTCCCT
TCCCCATTCCCCATCCAGCTCCTTTCCCCCTGGGTTTCCTTGGCTTCCTGCAGCAAATTGGGCAGTTCTC
TGCCCCTTGCCTAAAAGCCTGTACCTCTGGATTGGCGGAAGTAAATCTGGAAGGATTCTCACTCGTATTT
CCCACCCCTAGTGGCCAGAGGAGGGAGGGGCACAGTGAAGAAGGGAGCCCACCACCTCTCCGAAGAGGAA
AGCCACGTAGAGTGGTTGGCATGGGGTGCCAGCATCGTGCAAGCTCTGTCATAATCTGCATCTTCCCAGC
AGCCTGGTACCCCAGGTTCCTGTAACTCCCTGCCTCCTCCTCTCTTCTGCTGTTCTGCTCCTCCCAGACA
GAGCCTTTCCCTCACCCCCTGACCCCCTGGGCTGACCAAAATGTGCTTTCTACTGTGAGTCCCTATCCCA
AGATCCTGGGGAAAGGAGAGACCATGGTGTGAATGTAGAGATGCCACCTCCCTCTCTCTGAGGCAGGCCT
GTGGATGAAGGAGGAGGGTCAGGGCTGGCCTTCCTCTGTGCATCACTCTGCTAGGTTGGGGGCCCCCGAC
CCACCATACCTACGCCTAGGGAGCCCGTCCTCCAGTATTCCGTCTGTAGCAGGAGCTAGGGCTGCTGCCT
CAGCTCCAAGACAAGAATGAACCTGGCTGTGTCAGTCATTTTGTCTTTTCCTTTTTTTTTTTTTTTTGCC
ACATTGGCAGAGATGGGACCTAAGGGTCCCACCCCTCACCCCACCCCCACCTCTTCTGTATGTTTGAATT
CTTTCAGTAGCTGTTGATGCTGGTTGGACAGGTTTGAGTCAAATTGTACTTTGCTCCATTGTTAATTGAG
AAACTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006389.3
Synonyms GRP-170; Grp170; HSP12A; ORP-150; ORP150
Locus ID 10525
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents