BORIS(CTCFL) (NM_080618) Human 3' UTR Clone

CAT#: SC214474

3`UTR clone of CCCTC-binding factor (zinc finger protein)-like (CTCFL) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
1 Week

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BORIS(CTCFL) (NM_080618) Human 3' UTR Clone
Vector pMirTarget
Symbol CTCFL
Synonyms BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1
ACCN NM_080618
Insert Size 1397
Sequence Data
Insert Sequence
>SC214474 3'UTR clone of NM_080618
The sequence shown below is from the reference sequence of NM_080618. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACCTGTGAAATGCTCCTCAACACGATGGATAAGTGAGAGGGATTCGGGTTGCGTGTTCACTGCCCCCAA
TTCCTAAAGCAAGTTAGAAGTTTTTAGCATTTAAGGTGTGAAATGCTCCTCAACACGATGGATAAGTGAG
AGAGAGTCAGGTTGCATGTTCACTGCCCCTAATTCCTAAAGCAAGTTAGAAATTTTTAGCATTTTCTTTG
AAACAATTAAGTTCATGACAATGGATGACACAAGTTTGAGGTAGTGTCTAGAATTGTTCTCCTGTTTGTA
GCTGGATATTTCAAAGAAACATTGCAGGTATTTTATAAAAGTTTTAAACCTTGAATGAGAGGGTAACACC
TCAAACCTATGGATTCATTCACTTGATATTGGCAAGGTGGCCCACAATGAGTGAGTAGTGATTTTTGGAT
ATTTCAAAATAGTCTAGACCAGCTAGTGCTTCCACAGTCAAAGCTGGACATTTTTATGTTGCATTATATA
CACCCATGATATTTCTAATAATATATGGTTTTAAACATTAAAGACAAATGTTTTTATACAAATGAATTTT
CTACAAAATTTAAAGCTACCATAATGCTTTTAATTAGTTCTAAATTCAACCAAAAAATGTTTTACTCTTA
TAAAAAGGAAAACTGAGTAGGAAATGAAATACTAGATTAGACTAGAAAATAAGGAATAAATCGATTTTAC
TTTGGTATAGGAGCAAGGTTCACCTTTAGATTTTTGTATTCTCTTTTAATTATGCTCCTTGGCAGGTATG
AAATTGCCCTGGTTACATTCCATTATTGCTTATTAGTATTTCACTCCATAACCCTTTTTTCTGCTAAAAC
TACTCTTTTTATATTTGTAAAATAATTGGCAGAGTGAGAAGAAACATAAAATCAGATAAGGCAAATGTGT
ACCTGTAAGGAATTTGTACTTTTTCATAATGCCCAGTGATTAGTGAGTATTTCCCTTTTGCCAGTTGACA
AGATTTTTCCACCCTCGAGCAGCGTGAGAGATGCCTCTTTAACACTTGAAATTCATTTCTATCTGGATAC
AGAGGCAGATTTTTCTTCATTGCTTAGTTGAGCAGTTTGTTTTGCTGCCAACCTGTCTCCACCCCTGTAT
TTCAAGATCATTGATAAGCCCTAAATTCAAATTCTTAAGATATGGACCTTTTATTGAAAATATCACAAGT
TCAGAATCCCTATACAATGTGAATATGTGGAAATAATTTCCCAGCAGGAAGAGCATTATATTCTCTTTGT
ACCAGCAAATTAATTTAACTCAACTCACATGAGATTTAAATTCTGTGGGCTGTAGTATGCCATCATTGTG
ACTGAATTTGTGCAATGGTTTCTTAATTTTTTTACTGTTATTTAAAGATGTTTTACATAATTCAATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_080618.2
Synonyms BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1
Summary CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012].
Locus ID 140690
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents