IL8(CXCL8) (NM_000584) Human 3' UTR Clone

CAT#: SC213557

3`UTR clone of interleukin 8 (IL8) for miRNA target validation

Change vector?

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IL8(CXCL8) (NM_000584) Human 3' UTR Clone
Vector pMirTarget
Symbol CXCL8
Synonyms GCP-1; GCP1; IL8; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1
ACCN NM_000584
Insert Size 1289
Sequence Data
Insert Sequence
>SC213557 3'UTR clone of NM_000584
The sequence shown below is from the reference sequence of NM_000584. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAAAAAAATTCATTCTCTGTGGTATCC
AAGAATCAGTGAAGATGCCAGTGAAACTTCAAGCAAATCTACTTCAACACTTCATGTATTGTGTGGGTCT
GTTGTAGGGTTGCCAGATGCAATACAAGATTCCTGGTTAAATTTGAATTTCAGTAAACAATGAATAGTTT
TTCATTGTACCATGAAATATCCAGAACATACTTATATGTAAAGTATTATTTATTTGAATCTACAAAAAAC
AACAAATAATTTTTAAATATAAGGATTTTCCTAGATATTGCACGGGAGAATATACAAATAGCAAAATTGA
GGCCAAGGGCCAAGAGAATATCCGAACTTTAATTTCAGGAATTGAATGGGTTTGCTAGAATGTGATATTT
GAAGCATCACATAAAAATGATGGGACAATAAATTTTGCCATAAAGTCAAATTTAGCTGGAAATCCTGGAT
TTTTTTCTGTTAAATCTGGCAACCCTAGTCTGCTAGCCAGGATCCACAAGTCCTTGTTCCACTGTGCCTT
GGTTTCTCCTTTATTTCTAAGTGGAAAAAGTATTAGCCACCATCTTACCTCACAGTGATGTTGTGAGGAC
ATGTGGAAGCACTTTAAGTTTTTTCATCATAACATAAATTATTTTCAAGTGTAACTTATTAACCTATTTA
TTATTTATGTATTTATTTAAGCATCAAATATTTGTGCAAGAATTTGGAAAAATAGAAGATGAATCATTGA
TTGAATAGTTATAAAGATGTTATAGTAAATTTATTTTATTTTAGATATTAAATGATGTTTTATTAGATAA
ATTTCAATCAGGGTTTTTAGATTAAACAAACAAACAATTGGGTACCCAGTTAAATTTTCATTTCAGATAA
ACAACAAATAATTTTTTAGTATAAGTACATTATTGTTTATCTGAAATTTTAATTGAACTAACAATCCTAG
TTTGATACTCCCAGTCTTGTCATTGCCAGCTGTGTTGGTAGTGCTGTGTTGAATTACGGAATAATGAGTT
AGAACTATTAAAACAGCCAAAACTCCACAGTCAATATTAGTAATTTCTTGCTGGTTGAAACTTGTTTATT
ATGTACAAATAGATTCTTATAATATTATTTAAATGACTGCATTTTTAAATACAAGGCTTTATATTTTTAA
CTTTAAGATGTTTTTATGTGCTCTCCAAATTTTTTTTACTGTTTCTGATTGTATGGAAATATAAAAGTAA
ATATGAAACATTTAAAATATAATTTGTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000584.2
Synonyms GCP-1; GCP1; IL8; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1
Summary The protein encoded by this gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a potent angiogenic factor. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. This gene and other ten members of the CXC chemokine gene family form a chemokine gene cluster in a region mapped to chromosome 4q. [provided by RefSeq, Jul 2008]
Locus ID 3576
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents