FAK(PTK2) (NM_153831) Human 3' UTR Clone

CAT#: SC212185

3`UTR clone of PTK2 protein tyrosine kinase 2 (PTK2) transcript variant 1 for miRNA target validation

Need custom modification / cloning service?
Get a free quote

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name FAK(PTK2) (NM_153831) Human 3' UTR Clone
Vector pMirTarget
Symbol PTK2
Synonyms FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71
ACCN NM_153831
Insert Size 1070
Sequence Data
>SC212185 3'UTR clone of NM_153831
The sequence shown below is from the reference sequence of NM_153831. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AATGCTTGGGCAGACGAGACCACACTGAGCCTCCCCTAGGAGCACGTCTTGCTACCCTCTTTTGAAGATG
TTCTCTAGCCTTCCACCAGCAGCGAGGAATTAACCCTGTGTCCTCAGTCGCCAGCACTTACAGCTCCAAC
TTTTTTGAATGACCATCTGGTTGAAAAATCTTTCTCATATAAGTTTAACCACACTTTGATTTGGGTTCAT
TTTTTGTTTTGTTTTTTTCAATCATGATATTCAGAAAAATCCAGGATCCAAAATGTGGCGTTTTTCTAAG
AATGAAAATTATATGTAAGCTTTTAAGCATCATGAAGAACAATTTATGTTCACATTAAGATACGTTCTAA
AGGGGGATGGCCAAGGGGTGACATCTTAATTCCTAAACTACCTTAGCTGCATAGTGGAAGAGGAGAGCAT
GAAGCAAAGAATTCCAGGAAACCCAAGAGGCTGAGAATTCTTTTGTCTACCATAGAATTATTATCCAGAC
TGGAATTTTTGTTTGTTAGAACACCCTTCAGTTGCAATATGCTAATCCCACTTTACAAAGAATATAAAAG
CTATATTTTGAAGACTTGAGTTATTTCAGAAAAAACTACAGCCCTTTTTGTCTTACCTGCCTTTTACTTT
CGTGTGGATATGTGAAGCATTGGGTCGGGAACTAGCTGTAGAACACAACTAAAAACTCATGTCTTTTTTC
ACAGAATAATGTGCCAGTTTTTTGTAGCAATGTTATTTCTCTTGGAAGCAGAAATGCTTTGTACCAGAGC
ACCTCCAAACTGCATTGAGGAGAAGTTCCAGAACCATCCCCTTTTTCCATTTTTATATAATTTATAAAGA
AAGATTAAAGCCATGTTGACTATTTTACAGCCACTGGAGTTAACTAACCCTTCCTTGTATCTGTCTTCCC
AGGAGAGAATGAAGCAAAACAGGAATTTGGTTTTCTTTTGATGTCCAGTTACACCATCCATTCTGTTAAT
TTTGAAAAAATATACCCTCCCTTTAGTTTGTTGGGGGATATAAATTATTCTCAGGAAGAATATAATGAAC
TGTACAGTTACTTTGACCTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_153831.2
Synonyms FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71
Summary This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015].
Locus ID 5747
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents