SNAIL(SNAI1) (NM_005985) Human 3' UTR Clone

CAT#: SC210383

3`UTR clone of snail homolog 1 (Drosophila) (SNAI1) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SNAIL(SNAI1) (NM_005985) Human 3' UTR Clone
Vector pMirTarget
Symbol SNAI1
Synonyms dJ710H13.1; SLUGH2; SNA; SNAH; SNAIL; SNAIL1
ACCN NM_005985
Insert Size 865
Sequence Data
Insert Sequence
>SC210383 3'UTR clone of NM_005985
The sequence shown below is from the reference sequence of NM_005985. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCTCCACAAGCACCAAGAGTCCGGCTGCTCAGGATGTCCCCGCTGACCCTCGAGGCTCCCTCTTCCTCT
CCATACCTGCCCCTGCCTGACAGCCTTCCCCAGCTCCAGCAGGAAGGACCCCACATCCTTCTCACTGCCA
TGGAATTCCCTCCTGAGTGCCCCACTTCTGGCCACATCAGCCCCACAGGACTTTGATGAAGACCATTTTC
TGGTTCTGTGTCCTCTGCCTGGGCTCTGGAAGAGGCCTTCCCATGGCCATTTCTGTGGAGGGAGGGCAGC
TGGCCCCCAGCCCTGGGGGATTCCTGAGCTGGCCTGTCTGCGTGGGTTTTTGTATCCAGAGCTGTTTGGA
TACAGCTGCTTTGAGCTACAGGACAAAGGCTGACAGACTCACTGGGAAGCTCCCACCCCACTCAGGGGAC
CCCACTCCCCTCACACACACCCCCCCACAAGGAACCCTCAGGCCACCCTCCACGAGGTGTGACTAACTAT
GCAATAATCCACCCCCAGGTGCAGCCCCAGGGCCTGCGGAGGCGGTGGCAGACTAGAGTCTGAGATGCCC
CGAGCCCAGGCAGCTATTTCAGCCTCCTGTTTGGTGGGGTGGCACCTGTTTCCCGGGCAATTTAACAATG
TCTGAAAAGGGACTGTGAGTAATGGCTGTCACTTGTCGGGGGCCCAAGTGGGGTGCTCTGGTCTGACCGA
TGTGTCTCCCAGAACTATTCTGGGGGCCCGACAGGTGGGCCTGGGAGGAAGATGTTTACATTTTTAAAGG
TACACTGGTATTTATATTTCAAACATTTTGTATCAAGGAAACGTTTTGTATAGTTATATGTACAGTTTAT
TGATATTCAATAAAGCAGTTAATTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005985.2
Synonyms dJ710H13.1; SLUGH2; SNA; SNAH; SNAIL; SNAIL1
Summary The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2. [provided by RefSeq, Jul 2008]
Locus ID 6615
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents